ID: 981873531

View in Genome Browser
Species Human (GRCh38)
Location 4:149515162-149515184
Sequence GTTATCTCCAAAAGATGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981873531_981873540 26 Left 981873531 4:149515162-149515184 CCCTGCCATCTTTTGGAGATAAC No data
Right 981873540 4:149515211-149515233 CTTGGCCTGTTACTAGGCTTTGG No data
981873531_981873538 8 Left 981873531 4:149515162-149515184 CCCTGCCATCTTTTGGAGATAAC No data
Right 981873538 4:149515193-149515215 TTTTTTTGAGAGGCAGCTCTTGG No data
981873531_981873534 -2 Left 981873531 4:149515162-149515184 CCCTGCCATCTTTTGGAGATAAC No data
Right 981873534 4:149515183-149515205 ACTACTCCCCTTTTTTTGAGAGG No data
981873531_981873539 20 Left 981873531 4:149515162-149515184 CCCTGCCATCTTTTGGAGATAAC No data
Right 981873539 4:149515205-149515227 GCAGCTCTTGGCCTGTTACTAGG No data
981873531_981873541 29 Left 981873531 4:149515162-149515184 CCCTGCCATCTTTTGGAGATAAC No data
Right 981873541 4:149515214-149515236 GGCCTGTTACTAGGCTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981873531 Original CRISPR GTTATCTCCAAAAGATGGCA GGG (reversed) Intergenic
No off target data available for this crispr