ID: 981873534

View in Genome Browser
Species Human (GRCh38)
Location 4:149515183-149515205
Sequence ACTACTCCCCTTTTTTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981873532_981873534 -3 Left 981873532 4:149515163-149515185 CCTGCCATCTTTTGGAGATAACT No data
Right 981873534 4:149515183-149515205 ACTACTCCCCTTTTTTTGAGAGG No data
981873533_981873534 -7 Left 981873533 4:149515167-149515189 CCATCTTTTGGAGATAACTACTC No data
Right 981873534 4:149515183-149515205 ACTACTCCCCTTTTTTTGAGAGG No data
981873531_981873534 -2 Left 981873531 4:149515162-149515184 CCCTGCCATCTTTTGGAGATAAC No data
Right 981873534 4:149515183-149515205 ACTACTCCCCTTTTTTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981873534 Original CRISPR ACTACTCCCCTTTTTTTGAG AGG Intergenic
No off target data available for this crispr