ID: 981873537

View in Genome Browser
Species Human (GRCh38)
Location 4:149515191-149515213
Sequence AAGAGCTGCCTCTCAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981873537_981873541 0 Left 981873537 4:149515191-149515213 CCTTTTTTTGAGAGGCAGCTCTT No data
Right 981873541 4:149515214-149515236 GGCCTGTTACTAGGCTTTGGTGG No data
981873537_981873544 22 Left 981873537 4:149515191-149515213 CCTTTTTTTGAGAGGCAGCTCTT No data
Right 981873544 4:149515236-149515258 GAAACCAAACGTTTGACTATGGG No data
981873537_981873539 -9 Left 981873537 4:149515191-149515213 CCTTTTTTTGAGAGGCAGCTCTT No data
Right 981873539 4:149515205-149515227 GCAGCTCTTGGCCTGTTACTAGG No data
981873537_981873543 21 Left 981873537 4:149515191-149515213 CCTTTTTTTGAGAGGCAGCTCTT No data
Right 981873543 4:149515235-149515257 GGAAACCAAACGTTTGACTATGG No data
981873537_981873540 -3 Left 981873537 4:149515191-149515213 CCTTTTTTTGAGAGGCAGCTCTT No data
Right 981873540 4:149515211-149515233 CTTGGCCTGTTACTAGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981873537 Original CRISPR AAGAGCTGCCTCTCAAAAAA AGG (reversed) Intergenic
No off target data available for this crispr