ID: 981873540

View in Genome Browser
Species Human (GRCh38)
Location 4:149515211-149515233
Sequence CTTGGCCTGTTACTAGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981873533_981873540 21 Left 981873533 4:149515167-149515189 CCATCTTTTGGAGATAACTACTC No data
Right 981873540 4:149515211-149515233 CTTGGCCTGTTACTAGGCTTTGG No data
981873536_981873540 -2 Left 981873536 4:149515190-149515212 CCCTTTTTTTGAGAGGCAGCTCT No data
Right 981873540 4:149515211-149515233 CTTGGCCTGTTACTAGGCTTTGG No data
981873537_981873540 -3 Left 981873537 4:149515191-149515213 CCTTTTTTTGAGAGGCAGCTCTT No data
Right 981873540 4:149515211-149515233 CTTGGCCTGTTACTAGGCTTTGG No data
981873532_981873540 25 Left 981873532 4:149515163-149515185 CCTGCCATCTTTTGGAGATAACT No data
Right 981873540 4:149515211-149515233 CTTGGCCTGTTACTAGGCTTTGG No data
981873535_981873540 -1 Left 981873535 4:149515189-149515211 CCCCTTTTTTTGAGAGGCAGCTC No data
Right 981873540 4:149515211-149515233 CTTGGCCTGTTACTAGGCTTTGG No data
981873531_981873540 26 Left 981873531 4:149515162-149515184 CCCTGCCATCTTTTGGAGATAAC No data
Right 981873540 4:149515211-149515233 CTTGGCCTGTTACTAGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981873540 Original CRISPR CTTGGCCTGTTACTAGGCTT TGG Intergenic
No off target data available for this crispr