ID: 981874104

View in Genome Browser
Species Human (GRCh38)
Location 4:149520084-149520106
Sequence GCCCACTAAATAATAATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981874101_981874104 12 Left 981874101 4:149520049-149520071 CCATTAAACAATATGTAGTACAA No data
Right 981874104 4:149520084-149520106 GCCCACTAAATAATAATGGTAGG No data
981874100_981874104 24 Left 981874100 4:149520037-149520059 CCTATTTTATATCCATTAAACAA No data
Right 981874104 4:149520084-149520106 GCCCACTAAATAATAATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981874104 Original CRISPR GCCCACTAAATAATAATGGT AGG Intergenic
No off target data available for this crispr