ID: 981881647

View in Genome Browser
Species Human (GRCh38)
Location 4:149620071-149620093
Sequence CACTTAAACCCGGCAGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981881641_981881647 9 Left 981881641 4:149620039-149620061 CCCAGCTACTCAGAAGGCTGAGG 0: 4034
1: 105705
2: 210194
3: 239846
4: 148354
Right 981881647 4:149620071-149620093 CACTTAAACCCGGCAGGTGGAGG No data
981881643_981881647 8 Left 981881643 4:149620040-149620062 CCAGCTACTCAGAAGGCTGAGGC 0: 3189
1: 92640
2: 197944
3: 230524
4: 154715
Right 981881647 4:149620071-149620093 CACTTAAACCCGGCAGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981881647 Original CRISPR CACTTAAACCCGGCAGGTGG AGG Intergenic
No off target data available for this crispr