ID: 981884075

View in Genome Browser
Species Human (GRCh38)
Location 4:149651616-149651638
Sequence AAACTACTGCAGTAACAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981884073_981884075 30 Left 981884073 4:149651563-149651585 CCACATTAAAAGTGAAAAAAAAA No data
Right 981884075 4:149651616-149651638 AAACTACTGCAGTAACAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981884075 Original CRISPR AAACTACTGCAGTAACAAAA TGG Intergenic
No off target data available for this crispr