ID: 981886691

View in Genome Browser
Species Human (GRCh38)
Location 4:149683413-149683435
Sequence ATTCACATTTGGCACATAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981886686_981886691 20 Left 981886686 4:149683370-149683392 CCTAGAAAGCAGCATGGTCTATG No data
Right 981886691 4:149683413-149683435 ATTCACATTTGGCACATAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981886691 Original CRISPR ATTCACATTTGGCACATAGT AGG Intergenic
No off target data available for this crispr