ID: 981887742

View in Genome Browser
Species Human (GRCh38)
Location 4:149697566-149697588
Sequence CAAATTTACCAGCACACCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981887734_981887742 28 Left 981887734 4:149697515-149697537 CCCTGGGAGTCAGGACGTGCCAT No data
Right 981887742 4:149697566-149697588 CAAATTTACCAGCACACCATTGG No data
981887737_981887742 9 Left 981887737 4:149697534-149697556 CCATAAATCAGGCTTTTTTGCCC No data
Right 981887742 4:149697566-149697588 CAAATTTACCAGCACACCATTGG No data
981887735_981887742 27 Left 981887735 4:149697516-149697538 CCTGGGAGTCAGGACGTGCCATA No data
Right 981887742 4:149697566-149697588 CAAATTTACCAGCACACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981887742 Original CRISPR CAAATTTACCAGCACACCAT TGG Intergenic
No off target data available for this crispr