ID: 981889768

View in Genome Browser
Species Human (GRCh38)
Location 4:149721447-149721469
Sequence CTGGAGACTCAGAAGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981889768_981889776 28 Left 981889768 4:149721447-149721469 CCTCCTCCCTTCTGAGTCTCCAG No data
Right 981889776 4:149721498-149721520 GTGCAGCCTTAGCTTAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981889768 Original CRISPR CTGGAGACTCAGAAGGGAGG AGG (reversed) Intergenic
No off target data available for this crispr