ID: 981892323

View in Genome Browser
Species Human (GRCh38)
Location 4:149752988-149753010
Sequence GATCTTATATTGGTTCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981892323_981892329 -9 Left 981892323 4:149752988-149753010 CCCCAAGGAACCAATATAAGATC No data
Right 981892329 4:149753002-149753024 TATAAGATCTGGTTCTGGACTGG No data
981892323_981892333 2 Left 981892323 4:149752988-149753010 CCCCAAGGAACCAATATAAGATC No data
Right 981892333 4:149753013-149753035 GTTCTGGACTGGGAACTTAGGGG No data
981892323_981892330 -8 Left 981892323 4:149752988-149753010 CCCCAAGGAACCAATATAAGATC No data
Right 981892330 4:149753003-149753025 ATAAGATCTGGTTCTGGACTGGG No data
981892323_981892332 1 Left 981892323 4:149752988-149753010 CCCCAAGGAACCAATATAAGATC No data
Right 981892332 4:149753012-149753034 GGTTCTGGACTGGGAACTTAGGG No data
981892323_981892331 0 Left 981892323 4:149752988-149753010 CCCCAAGGAACCAATATAAGATC No data
Right 981892331 4:149753011-149753033 TGGTTCTGGACTGGGAACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981892323 Original CRISPR GATCTTATATTGGTTCCTTG GGG (reversed) Intergenic
No off target data available for this crispr