ID: 981902510

View in Genome Browser
Species Human (GRCh38)
Location 4:149883193-149883215
Sequence TACTAGGTAGTTACTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981902510_981902511 -9 Left 981902510 4:149883193-149883215 CCTGCTCTAGTAACTACCTAGTA No data
Right 981902511 4:149883207-149883229 TACCTAGTAAATGTTCTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981902510 Original CRISPR TACTAGGTAGTTACTAGAGC AGG (reversed) Intergenic
No off target data available for this crispr