ID: 981903861

View in Genome Browser
Species Human (GRCh38)
Location 4:149896832-149896854
Sequence CCAGAAATGCAGAGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981903854_981903861 -7 Left 981903854 4:149896816-149896838 CCTATAGTATATATTCCCAGAAA No data
Right 981903861 4:149896832-149896854 CCAGAAATGCAGAGGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981903861 Original CRISPR CCAGAAATGCAGAGGGGAGA GGG Intergenic
No off target data available for this crispr