ID: 981908586

View in Genome Browser
Species Human (GRCh38)
Location 4:149952530-149952552
Sequence CAAGTTGTTGTCCTGGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981908586_981908591 -9 Left 981908586 4:149952530-149952552 CCCCACTCCAGGACAACAACTTG No data
Right 981908591 4:149952544-149952566 AACAACTTGGAATGACCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981908586 Original CRISPR CAAGTTGTTGTCCTGGAGTG GGG (reversed) Intergenic
No off target data available for this crispr