ID: 981910022

View in Genome Browser
Species Human (GRCh38)
Location 4:149968101-149968123
Sequence CAGTTTTTCTGGAGGATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981910022_981910027 22 Left 981910022 4:149968101-149968123 CCCTTGATCCTCCAGAAAAACTG No data
Right 981910027 4:149968146-149968168 ATTATAAGTGATCCTGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981910022 Original CRISPR CAGTTTTTCTGGAGGATCAA GGG (reversed) Intergenic
No off target data available for this crispr