ID: 981912655

View in Genome Browser
Species Human (GRCh38)
Location 4:149999646-149999668
Sequence TTTCTCTGCCTGGCAGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981912652_981912655 10 Left 981912652 4:149999613-149999635 CCAGATTCTCATAATGGAAATTA No data
Right 981912655 4:149999646-149999668 TTTCTCTGCCTGGCAGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981912655 Original CRISPR TTTCTCTGCCTGGCAGAAGG TGG Intergenic
No off target data available for this crispr