ID: 981914472

View in Genome Browser
Species Human (GRCh38)
Location 4:150018594-150018616
Sequence AACAGTTAACACTGTAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981914470_981914472 -9 Left 981914470 4:150018580-150018602 CCAGTGTTGGTAGGAACAGTTAA No data
Right 981914472 4:150018594-150018616 AACAGTTAACACTGTAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981914472 Original CRISPR AACAGTTAACACTGTAATGG AGG Intergenic
No off target data available for this crispr