ID: 981917113

View in Genome Browser
Species Human (GRCh38)
Location 4:150046547-150046569
Sequence CTAGTTCCCCAGTCCTATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981917113_981917116 15 Left 981917113 4:150046547-150046569 CCAAAATAGGACTGGGGAACTAG No data
Right 981917116 4:150046585-150046607 GTTTTTAAACAAATGTTCCTAGG No data
981917113_981917118 17 Left 981917113 4:150046547-150046569 CCAAAATAGGACTGGGGAACTAG No data
Right 981917118 4:150046587-150046609 TTTTAAACAAATGTTCCTAGGGG No data
981917113_981917117 16 Left 981917113 4:150046547-150046569 CCAAAATAGGACTGGGGAACTAG No data
Right 981917117 4:150046586-150046608 TTTTTAAACAAATGTTCCTAGGG No data
981917113_981917115 -7 Left 981917113 4:150046547-150046569 CCAAAATAGGACTGGGGAACTAG No data
Right 981917115 4:150046563-150046585 GAACTAGGATCAGATGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981917113 Original CRISPR CTAGTTCCCCAGTCCTATTT TGG (reversed) Intergenic
No off target data available for this crispr