ID: 981917115

View in Genome Browser
Species Human (GRCh38)
Location 4:150046563-150046585
Sequence GAACTAGGATCAGATGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981917113_981917115 -7 Left 981917113 4:150046547-150046569 CCAAAATAGGACTGGGGAACTAG No data
Right 981917115 4:150046563-150046585 GAACTAGGATCAGATGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981917115 Original CRISPR GAACTAGGATCAGATGAAAG TGG Intergenic
No off target data available for this crispr