ID: 981920173

View in Genome Browser
Species Human (GRCh38)
Location 4:150078323-150078345
Sequence GGCCTCCCTCCGCCGCCGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 145}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981920173_981920176 0 Left 981920173 4:150078323-150078345 CCTGTCGGCGGCGGAGGGAGGCC 0: 1
1: 0
2: 0
3: 22
4: 145
Right 981920176 4:150078346-150078368 AGAGCGCGGATGCTTGCCAGTGG 0: 1
1: 0
2: 0
3: 2
4: 63
981920173_981920179 6 Left 981920173 4:150078323-150078345 CCTGTCGGCGGCGGAGGGAGGCC 0: 1
1: 0
2: 0
3: 22
4: 145
Right 981920179 4:150078352-150078374 CGGATGCTTGCCAGTGGGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 151
981920173_981920182 23 Left 981920173 4:150078323-150078345 CCTGTCGGCGGCGGAGGGAGGCC 0: 1
1: 0
2: 0
3: 22
4: 145
Right 981920182 4:150078369-150078391 GCCGGGCCTGACCGCTGCGTGGG 0: 1
1: 0
2: 0
3: 10
4: 77
981920173_981920178 5 Left 981920173 4:150078323-150078345 CCTGTCGGCGGCGGAGGGAGGCC 0: 1
1: 0
2: 0
3: 22
4: 145
Right 981920178 4:150078351-150078373 GCGGATGCTTGCCAGTGGGCCGG 0: 1
1: 0
2: 0
3: 4
4: 87
981920173_981920186 29 Left 981920173 4:150078323-150078345 CCTGTCGGCGGCGGAGGGAGGCC 0: 1
1: 0
2: 0
3: 22
4: 145
Right 981920186 4:150078375-150078397 CCTGACCGCTGCGTGGGAGGCGG 0: 1
1: 0
2: 1
3: 14
4: 155
981920173_981920184 26 Left 981920173 4:150078323-150078345 CCTGTCGGCGGCGGAGGGAGGCC 0: 1
1: 0
2: 0
3: 22
4: 145
Right 981920184 4:150078372-150078394 GGGCCTGACCGCTGCGTGGGAGG 0: 1
1: 0
2: 1
3: 10
4: 127
981920173_981920177 1 Left 981920173 4:150078323-150078345 CCTGTCGGCGGCGGAGGGAGGCC 0: 1
1: 0
2: 0
3: 22
4: 145
Right 981920177 4:150078347-150078369 GAGCGCGGATGCTTGCCAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 40
981920173_981920181 22 Left 981920173 4:150078323-150078345 CCTGTCGGCGGCGGAGGGAGGCC 0: 1
1: 0
2: 0
3: 22
4: 145
Right 981920181 4:150078368-150078390 GGCCGGGCCTGACCGCTGCGTGG 0: 1
1: 0
2: 1
3: 13
4: 159
981920173_981920187 30 Left 981920173 4:150078323-150078345 CCTGTCGGCGGCGGAGGGAGGCC 0: 1
1: 0
2: 0
3: 22
4: 145
Right 981920187 4:150078376-150078398 CTGACCGCTGCGTGGGAGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981920173 Original CRISPR GGCCTCCCTCCGCCGCCGAC AGG (reversed) Intronic