ID: 981920175

View in Genome Browser
Species Human (GRCh38)
Location 4:150078344-150078366
Sequence ACTGGCAAGCATCCGCGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 34}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981920175_981920186 8 Left 981920175 4:150078344-150078366 CCAGAGCGCGGATGCTTGCCAGT 0: 1
1: 0
2: 0
3: 2
4: 34
Right 981920186 4:150078375-150078397 CCTGACCGCTGCGTGGGAGGCGG 0: 1
1: 0
2: 1
3: 14
4: 155
981920175_981920182 2 Left 981920175 4:150078344-150078366 CCAGAGCGCGGATGCTTGCCAGT 0: 1
1: 0
2: 0
3: 2
4: 34
Right 981920182 4:150078369-150078391 GCCGGGCCTGACCGCTGCGTGGG 0: 1
1: 0
2: 0
3: 10
4: 77
981920175_981920181 1 Left 981920175 4:150078344-150078366 CCAGAGCGCGGATGCTTGCCAGT 0: 1
1: 0
2: 0
3: 2
4: 34
Right 981920181 4:150078368-150078390 GGCCGGGCCTGACCGCTGCGTGG 0: 1
1: 0
2: 1
3: 13
4: 159
981920175_981920184 5 Left 981920175 4:150078344-150078366 CCAGAGCGCGGATGCTTGCCAGT 0: 1
1: 0
2: 0
3: 2
4: 34
Right 981920184 4:150078372-150078394 GGGCCTGACCGCTGCGTGGGAGG 0: 1
1: 0
2: 1
3: 10
4: 127
981920175_981920189 29 Left 981920175 4:150078344-150078366 CCAGAGCGCGGATGCTTGCCAGT 0: 1
1: 0
2: 0
3: 2
4: 34
Right 981920189 4:150078396-150078418 GGGCTGCATTATTTCCCGCTAGG 0: 1
1: 0
2: 0
3: 7
4: 63
981920175_981920190 30 Left 981920175 4:150078344-150078366 CCAGAGCGCGGATGCTTGCCAGT 0: 1
1: 0
2: 0
3: 2
4: 34
Right 981920190 4:150078397-150078419 GGCTGCATTATTTCCCGCTAGGG 0: 1
1: 0
2: 0
3: 3
4: 53
981920175_981920187 9 Left 981920175 4:150078344-150078366 CCAGAGCGCGGATGCTTGCCAGT 0: 1
1: 0
2: 0
3: 2
4: 34
Right 981920187 4:150078376-150078398 CTGACCGCTGCGTGGGAGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981920175 Original CRISPR ACTGGCAAGCATCCGCGCTC TGG (reversed) Intronic