ID: 981920184

View in Genome Browser
Species Human (GRCh38)
Location 4:150078372-150078394
Sequence GGGCCTGACCGCTGCGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981920175_981920184 5 Left 981920175 4:150078344-150078366 CCAGAGCGCGGATGCTTGCCAGT 0: 1
1: 0
2: 0
3: 2
4: 34
Right 981920184 4:150078372-150078394 GGGCCTGACCGCTGCGTGGGAGG 0: 1
1: 0
2: 1
3: 10
4: 127
981920173_981920184 26 Left 981920173 4:150078323-150078345 CCTGTCGGCGGCGGAGGGAGGCC 0: 1
1: 0
2: 0
3: 22
4: 145
Right 981920184 4:150078372-150078394 GGGCCTGACCGCTGCGTGGGAGG 0: 1
1: 0
2: 1
3: 10
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981920184 Original CRISPR GGGCCTGACCGCTGCGTGGG AGG Intronic