ID: 981920368

View in Genome Browser
Species Human (GRCh38)
Location 4:150079023-150079045
Sequence ACTCCTGGTGCTGGCCATCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 131}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981920368_981920378 24 Left 981920368 4:150079023-150079045 CCGCGATGGCCAGCACCAGGAGT 0: 1
1: 0
2: 1
3: 7
4: 131
Right 981920378 4:150079070-150079092 CGGGACAAAAGGCCGCGGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 126
981920368_981920379 25 Left 981920368 4:150079023-150079045 CCGCGATGGCCAGCACCAGGAGT 0: 1
1: 0
2: 1
3: 7
4: 131
Right 981920379 4:150079071-150079093 GGGACAAAAGGCCGCGGCCGGGG 0: 1
1: 0
2: 21
3: 219
4: 617
981920368_981920372 -1 Left 981920368 4:150079023-150079045 CCGCGATGGCCAGCACCAGGAGT 0: 1
1: 0
2: 1
3: 7
4: 131
Right 981920372 4:150079045-150079067 TATCGAGCTGGAGCACTTTGAGG 0: 1
1: 0
2: 0
3: 6
4: 61
981920368_981920373 4 Left 981920368 4:150079023-150079045 CCGCGATGGCCAGCACCAGGAGT 0: 1
1: 0
2: 1
3: 7
4: 131
Right 981920373 4:150079050-150079072 AGCTGGAGCACTTTGAGGAACGG 0: 1
1: 0
2: 4
3: 26
4: 313
981920368_981920376 19 Left 981920368 4:150079023-150079045 CCGCGATGGCCAGCACCAGGAGT 0: 1
1: 0
2: 1
3: 7
4: 131
Right 981920376 4:150079065-150079087 AGGAACGGGACAAAAGGCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 111
981920368_981920374 5 Left 981920368 4:150079023-150079045 CCGCGATGGCCAGCACCAGGAGT 0: 1
1: 0
2: 1
3: 7
4: 131
Right 981920374 4:150079051-150079073 GCTGGAGCACTTTGAGGAACGGG 0: 1
1: 0
2: 3
3: 66
4: 320
981920368_981920377 23 Left 981920368 4:150079023-150079045 CCGCGATGGCCAGCACCAGGAGT 0: 1
1: 0
2: 1
3: 7
4: 131
Right 981920377 4:150079069-150079091 ACGGGACAAAAGGCCGCGGCCGG 0: 1
1: 0
2: 1
3: 25
4: 168
981920368_981920375 13 Left 981920368 4:150079023-150079045 CCGCGATGGCCAGCACCAGGAGT 0: 1
1: 0
2: 1
3: 7
4: 131
Right 981920375 4:150079059-150079081 ACTTTGAGGAACGGGACAAAAGG 0: 1
1: 0
2: 0
3: 7
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981920368 Original CRISPR ACTCCTGGTGCTGGCCATCG CGG (reversed) Exonic
900996100 1:6124449-6124471 GCTCCTGGTGCTGTCCCTTGTGG - Intronic
901758946 1:11458401-11458423 GCTTCTGGTGGTGGCAATCGTGG - Intergenic
901891976 1:12274597-12274619 ACCACTGGGGCTGGGCATCGTGG - Intronic
902250227 1:15149873-15149895 GCTCCTAGTGCTGGGCATTGAGG + Intergenic
902534677 1:17112621-17112643 ACACCTGGTGCTCGGCATGGTGG + Intronic
902850230 1:19149553-19149575 ACTCTTGGTGTTGGCCATGTCGG - Intronic
904501569 1:30915719-30915741 AGTCCTGCCGCTGGCCATGGTGG + Intergenic
907209781 1:52810697-52810719 ACTCCTGCTTCTGGCCAAGGTGG - Intronic
912682793 1:111739588-111739610 ACACCTGGTCCCGGCCAGCGCGG + Intronic
920458161 1:206116740-206116762 TGTCCTGGTGCTGGCGACCGGGG - Exonic
920932763 1:210404381-210404403 ACTGCAGGTGCTGGCCAGCAGGG - Intronic
1065040878 10:21694847-21694869 AATCCAGGTGCTGGCCAGCTGGG + Intronic
1066726681 10:38402604-38402626 GCAGCTGGTGCTGGCCATTGAGG + Intergenic
1070704282 10:78626502-78626524 CCACCTGGTGCTGGCCACCACGG + Intergenic
1072046146 10:91657049-91657071 ACTTCTGTTTCTGGCCATCAAGG - Intergenic
1072247780 10:93558601-93558623 ACTCCTGTTGCTTGCCACCAAGG - Intergenic
1074108982 10:110409210-110409232 ACCCCTGGTGCTGGCCAGTATGG + Intergenic
1075417331 10:122274373-122274395 ACTCCTGGTGCGTGCCACCCAGG + Intronic
1076900483 10:133335333-133335355 ACTCCTGGCGCGGGCCCTCCGGG - Intronic
1077082326 11:729571-729593 TCTGCTGGTGCTGGCCCTGGTGG + Intergenic
1077417134 11:2429559-2429581 GATCCTGGTGGTGGCCATGGTGG + Intergenic
1081619819 11:44612922-44612944 AATGCTGGGGCTGGCCATGGTGG - Intronic
1082068185 11:47917670-47917692 ACTACAGGTGCAGGCCATCATGG + Intergenic
1083949136 11:65944407-65944429 ACGCCTGGTGCTGACCACTGAGG - Intergenic
1085230726 11:74967460-74967482 TCTTCTGTTGCTGGGCATCGTGG + Intronic
1087037725 11:93771899-93771921 ACTTCTGGTGCTGGCCAAGATGG + Intronic
1089562933 11:119354523-119354545 ACTCTTGGGGCTGGGCATGGTGG - Intergenic
1091273179 11:134332106-134332128 ACTCCTGCTGCTGGTCGTCTTGG + Exonic
1093436870 12:19145643-19145665 ACTCCTGTTGTTGGACATCGAGG + Intronic
1095685414 12:45028045-45028067 ATTCCTCTTGCTGGCAATCGAGG + Intronic
1097379186 12:58874882-58874904 AATCCTGGTTCTGGTCATCTGGG - Intronic
1102582818 12:113901800-113901822 ATTCCTGGGGCTGGGCATGGTGG - Intronic
1104856185 12:131903537-131903559 ACTCCCTGAGCTGGGCATCGGGG - Intronic
1110029625 13:70590925-70590947 AGACCTGGTGCTTGCCATCATGG - Intergenic
1112784547 13:102937850-102937872 ACTCCTGCTGCAGGCCGTCCTGG + Intergenic
1113090762 13:106615629-106615651 ACTCCTGGTGCTGAAGATGGTGG + Intergenic
1113650369 13:112030111-112030133 AACCCTGGTGCTGGGCATCAAGG + Intergenic
1114007670 14:18332396-18332418 ACTCCAGATGCTGGTCAACGAGG + Intergenic
1121239467 14:92418335-92418357 CCTCCTGGTTCTGCCCATCTTGG + Intronic
1122802124 14:104236682-104236704 ACTCCTGGTGCTGCCCTGTGTGG - Intergenic
1126169549 15:45683462-45683484 ACTGCTGGTGCAGAACATCGAGG - Intronic
1131957946 15:97757748-97757770 GCTGCTGGTGCTGGCCTTGGAGG - Intergenic
1132600952 16:772745-772767 TGCCCTGCTGCTGGCCATCGGGG - Exonic
1136247829 16:28985453-28985475 GCTCCTGCTGCTGCCCATCCTGG + Exonic
1140140449 16:72251720-72251742 AGCCCTGGTGCTGGCCAGCATGG - Intergenic
1144128678 17:12225214-12225236 ACTCCTGGGCCTGGCCTTCTAGG + Intergenic
1146030095 17:29358878-29358900 ACTCCAGGTGCCCGCCATCAAGG + Intergenic
1146525305 17:33562543-33562565 TCTCCTGGTGGTGGCCCTCCAGG - Intronic
1147429678 17:40363695-40363717 CATCCTGGTGCTGGCCACGGTGG - Exonic
1148504774 17:48118813-48118835 ACGGCTGGTGCTGGCCACCAAGG + Intronic
1148584211 17:48765834-48765856 AGTCATGGTGCTGGGCATGGTGG - Intronic
1151363567 17:73603174-73603196 CCACCTTGTGCTGGCCATAGGGG + Intronic
1151970830 17:77456652-77456674 AGACCTGGTACTGGCCATGGAGG - Intronic
1151970899 17:77456892-77456914 AGACCTGGTACTGGCCATAGGGG - Intronic
1154031958 18:10761084-10761106 CCTCCTGATGCTGGCTATCCTGG - Exonic
1154311832 18:13272861-13272883 ATTCCTGGTGCTGGCCGATGAGG + Intronic
1155215259 18:23637683-23637705 ACTACTGGAGCTGGCCAAGGTGG - Intronic
1157283305 18:46360265-46360287 ACTCCTGCTGCTGGGCACAGAGG + Intronic
1160709378 19:544092-544114 ACTGCTGGTGCTGGCCCTGGGGG + Exonic
1160958061 19:1703840-1703862 ACTCCTGGGGCTGGGCACGGTGG - Intergenic
1161788943 19:6347064-6347086 ACTCGTGGTGTTGGCCAGGGTGG - Intergenic
1161870037 19:6862933-6862955 ACTACTGCTGCTGTCCATCAGGG - Intergenic
1163726555 19:18926346-18926368 CCACCTGGTGCACGCCATCGAGG + Exonic
1164596356 19:29533040-29533062 AGTCTCGGTGCTGGCCATGGAGG + Intronic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1166475070 19:43116661-43116683 AATCCTGGTGTTGACCACCGAGG - Intronic
1167447755 19:49548476-49548498 ATTACTGGTGCCGGCCACCGTGG + Intergenic
1168268894 19:55239094-55239116 ACTCCTGGAGCTAGCCTTAGGGG - Intronic
925210487 2:2041630-2041652 CCTCCTGGGGCCGGCCATGGGGG - Intronic
927101063 2:19788216-19788238 ACTCCTGGTGCTGGGCATGGTGG + Intergenic
927640232 2:24841269-24841291 CCTCATGGGGCTGGCCATGGTGG - Exonic
927927626 2:27024687-27024709 ACTCCTGCCCCTGGCCATCCAGG - Intronic
929581383 2:43083574-43083596 ACTCTTGCTGCTGGCCAACCAGG + Intergenic
932448772 2:71796451-71796473 ATTCCTGATGCTGGCCCTCGAGG - Intergenic
933936618 2:87209152-87209174 ACTCCTTGAGCTGGGCATTGTGG - Intergenic
934527339 2:95059892-95059914 ACTCCTGCTTCTGGGCATCCTGG + Intergenic
935591172 2:104846476-104846498 ACCCCTGAGGCTGGCCATCCAGG + Intergenic
936053721 2:109244793-109244815 CCTCCTGCTGCTGGCCTTGGAGG + Intronic
938366404 2:130737882-130737904 ACCCTTGGTGCTGGCCAGTGAGG - Intergenic
938528888 2:132163007-132163029 ACTCCAGATGCTGGTCAACGAGG - Intronic
941465517 2:165821721-165821743 ACACCTGGGGCTGGGCATGGTGG + Intergenic
942085048 2:172435914-172435936 ACTCTTGGGGCTGGGCATGGTGG - Intronic
942684063 2:178512056-178512078 AATCCTGGTGCTGTGCATCTTGG - Exonic
1171164165 20:22956093-22956115 AGGTCTGGTGCTGGCCATCAGGG + Intergenic
1171205128 20:23273131-23273153 TCTCCAGGTACTGGCCATCAGGG + Intergenic
1173142323 20:40495055-40495077 ACTCTTGCTTCTGGCCATCAGGG - Intergenic
1176767617 21:13036905-13036927 ACTCCAGATGCTGGTCAACGAGG + Intergenic
1180108704 21:45637546-45637568 AGTCCCGGGGCCGGCCATCGTGG - Intergenic
1180108721 21:45637602-45637624 AGTCCCGGGGCCGGCCATCGTGG - Intergenic
1180108738 21:45637658-45637680 AGTCCCGGGGCCGGCCATCGTGG - Intergenic
1180108755 21:45637714-45637736 AGTCCCGGGGCCGGCCATCGTGG - Intergenic
1180108772 21:45637770-45637792 AGTCCCGGGGCCGGCCATCGTGG - Intergenic
1180108789 21:45637826-45637848 AGTCCCGGGGCCGGCCATCGTGG - Intergenic
1180108806 21:45637882-45637904 AGTCCCGGGGCCGGCCATCGTGG - Intergenic
1180404408 22:12537272-12537294 ATTCCTGGGGCTGGGCATGGTGG - Intergenic
1180514744 22:16131143-16131165 ACTCCAGATGCTGGTCAACGAGG + Intergenic
1181258358 22:21579277-21579299 ACACCTGGGGCTGGGCATGGTGG - Intronic
1183363398 22:37394561-37394583 ACTCACGGTGCTGGCCACTGCGG - Intronic
953140698 3:40226858-40226880 ACTCCTGAGGCTGGCATTCGGGG + Intronic
953409549 3:42682742-42682764 AGTCCTGATGCTGGCCCACGGGG + Intergenic
954004203 3:47578793-47578815 GCTCCTCGCGCTGCCCATCGTGG - Exonic
954026157 3:47784968-47784990 ACTCTAGGAGCTGGCCATGGTGG + Intergenic
958599666 3:96279073-96279095 AGGCCTGGTGGTGGCCATCGAGG - Intergenic
961454757 3:127018395-127018417 TCTCCTGCTGCTGGTCATCGTGG + Exonic
966636040 3:182134935-182134957 ACTCCTGGTGGCGGCCGTGGTGG + Intergenic
968764175 4:2459485-2459507 ACTCCTGGGGGTGGCCAAGGTGG + Intronic
974438186 4:61883872-61883894 ACACATTGTGCTGGGCATCGGGG - Intronic
981482024 4:145248507-145248529 AATTCTGGTGCTGGGCATGGTGG - Intergenic
981920368 4:150079023-150079045 ACTCCTGGTGCTGGCCATCGCGG - Exonic
985625395 5:982817-982839 AGCCCTGGAGCAGGCCATCGGGG + Intergenic
985673111 5:1216455-1216477 ACTCCTGGGGCTGGCGCTCTGGG + Intronic
986658082 5:10034903-10034925 AGTCTTGGTGCTTGCCATCTTGG - Intergenic
990372448 5:55134473-55134495 ACTCCTGGGGCTGGGCACGGTGG + Intronic
999120200 5:149203662-149203684 GCTGCTGGTGCTGGCGATAGTGG - Intronic
999218959 5:149959503-149959525 ACTCCTGATGCTGCCCCTTGTGG - Intergenic
1011853781 6:91663356-91663378 CCACCTGGTGCTGTCCATCCAGG + Intergenic
1013225241 6:108115894-108115916 CCACCTGGTGCTGGACGTCGAGG + Intronic
1015255941 6:131179519-131179541 AGTCATGGTCCTGGCCCTCGTGG - Intronic
1019361375 7:605901-605923 ACTGCTGGGGCTGGCCAGGGCGG - Intronic
1019702076 7:2478864-2478886 ACCCCTGAGGCTGGCCAGCGGGG - Intergenic
1019709103 7:2510272-2510294 ACACCTGCTGCTGGCCATGTGGG + Intergenic
1020186309 7:5961951-5961973 ACTACAGGTGCTGGCCACCAAGG + Intronic
1020296605 7:6762823-6762845 ACTACAGGTGCTGGCCACCAAGG - Intronic
1021639608 7:22724658-22724680 ACTCCTGATAGTGGCCCTCGAGG - Intergenic
1023272532 7:38480264-38480286 ACTCCTGGCGCTGGTCACTGGGG - Intronic
1024493114 7:50009343-50009365 ACTGCTGGACCTGGCCATCTGGG - Intronic
1026629781 7:72028196-72028218 TCTCCTGGTGCTGGCAAGCATGG - Intronic
1027268073 7:76504874-76504896 ACCCCTGGTGCTGGCCTGGGGGG - Intronic
1028340000 7:89706559-89706581 AATAGTGGTGCTGGCCATCTAGG + Intergenic
1029551646 7:101239877-101239899 ACTCGTGGGCATGGCCATCGTGG - Exonic
1034832194 7:154319031-154319053 CCTCCTGCTGCTGGCCCTGGGGG - Intronic
1037910754 8:22742326-22742348 CCCGCTGGTGCAGGCCATCGAGG - Intronic
1049236678 8:141515604-141515626 AGTGCTGGGGCTGGCCCTCGAGG - Intronic
1049389839 8:142362017-142362039 CCTCCTGCTGCAGGCCATCGGGG - Intronic
1052295473 9:26892605-26892627 ACTGCTGCCGCTGGCCAACGCGG + Exonic
1053474671 9:38373482-38373504 ACTCCTGTTGCTGGCCATTTAGG - Intergenic
1061936388 9:133859913-133859935 ACTCAGGGTGCTGGGCACCGGGG + Intronic
1062592236 9:137279472-137279494 ACTCTTGGTGCTGGACGACGTGG + Exonic
1203773357 EBV:60302-60324 CCTCCTGGTGCCGGCCCTCAGGG - Intergenic
1192727804 X:73770120-73770142 CCTCCTGGTGCTGGCCAAGATGG + Intergenic