ID: 981920537

View in Genome Browser
Species Human (GRCh38)
Location 4:150079813-150079835
Sequence TGCACCAGGGTCCACACCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981920537_981920542 3 Left 981920537 4:150079813-150079835 CCCTCGGTGTGGACCCTGGTGCA 0: 1
1: 0
2: 0
3: 15
4: 74
Right 981920542 4:150079839-150079861 TCCTGTCATGTTCCAGTATTCGG 0: 1
1: 0
2: 0
3: 16
4: 159
981920537_981920545 5 Left 981920537 4:150079813-150079835 CCCTCGGTGTGGACCCTGGTGCA 0: 1
1: 0
2: 0
3: 15
4: 74
Right 981920545 4:150079841-150079863 CTGTCATGTTCCAGTATTCGGGG No data
981920537_981920544 4 Left 981920537 4:150079813-150079835 CCCTCGGTGTGGACCCTGGTGCA 0: 1
1: 0
2: 0
3: 15
4: 74
Right 981920544 4:150079840-150079862 CCTGTCATGTTCCAGTATTCGGG 0: 1
1: 0
2: 1
3: 52
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981920537 Original CRISPR TGCACCAGGGTCCACACCGA GGG (reversed) Intronic