ID: 981922499

View in Genome Browser
Species Human (GRCh38)
Location 4:150100403-150100425
Sequence GTGTAGAAACAGGTTGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 562}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981922497_981922499 -4 Left 981922497 4:150100384-150100406 CCTTGTGGATATGTCAACTGTGT 0: 1
1: 0
2: 0
3: 15
4: 170
Right 981922499 4:150100403-150100425 GTGTAGAAACAGGTTGACCAAGG 0: 1
1: 0
2: 0
3: 13
4: 562

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981922499 Original CRISPR GTGTAGAAACAGGTTGACCA AGG Intronic
901030484 1:6304781-6304803 GTGTAGAAAGAGGTAGACATGGG - Intronic
901100305 1:6714894-6714916 GTGTAGAAAGAGGTAGACGTGGG - Intergenic
901223869 1:7600869-7600891 GTGTAGAAAGAGGTAGACATGGG - Intronic
901726891 1:11249805-11249827 GTGTAGAAAGAGGTAGACATGGG - Intronic
902828299 1:18992700-18992722 GTGGAGAAACAGGTTGAGGCTGG - Intergenic
902877157 1:19347608-19347630 CTGGACAAACAAGTTGACCAAGG - Intronic
903103673 1:21054077-21054099 GTGTAGAAAGAGGTAGACATGGG + Intronic
903458490 1:23504578-23504600 GTGTAGAAAGAGGTAGACATGGG + Intergenic
903508302 1:23853671-23853693 GTGTAGAAAGAGGTAGACACGGG + Intronic
903748659 1:25604554-25604576 GTGTAGAAAGAGGTAGACATGGG + Intergenic
904046629 1:27613083-27613105 GTGTTGGAACAGGTGGAGCAGGG - Exonic
905427732 1:37897341-37897363 GTGTAGAAAGAGGTAGACATGGG + Intronic
905686511 1:39912862-39912884 GTGTAGAAAGAGGTAGACATGGG - Intergenic
906429063 1:45740209-45740231 GTGTAGAAAGAGGTAGACATGGG - Intronic
906695689 1:47821806-47821828 GTGTACAAAGAGGGTGACCAGGG - Intronic
907216502 1:52869631-52869653 GTGTAGAAAGAGGTAGACATGGG - Intronic
908108348 1:60869784-60869806 GTGTATAAATATGTTTACCATGG - Intronic
909478747 1:76111825-76111847 GTGTAGAAAGAGGTAGACATGGG - Intronic
910356594 1:86364308-86364330 GTGTACATACAGGTTGCCCAGGG - Intronic
911325741 1:96469482-96469504 GTGTAGAAAGAGGTAGACGCGGG - Intergenic
911351534 1:96762116-96762138 GTGTAGAAAGAGGTAGACATGGG - Intronic
912266079 1:108159852-108159874 GTGTAGAAAGAGGTAGACATGGG - Intronic
912302876 1:108535863-108535885 GTGTAGAAAGAGGTAGACATGGG - Intergenic
912371385 1:109176992-109177014 GTGTAGAAAGAGGTAGACATGGG - Intronic
912454037 1:109785987-109786009 GTGCAGAAAGAGGTTGCCCTGGG + Intergenic
912660905 1:111529755-111529777 GTGTAGAAAGAGGTAGACATGGG - Intronic
912668817 1:111607398-111607420 GTGTAGAAAGAGGTAGACATGGG - Intronic
913021038 1:114790348-114790370 GTGTAGAAAGAGGTAGACATGGG - Intergenic
914002468 1:143703746-143703768 GTGTAGAAAGAGGTAGACATGGG + Intergenic
914231228 1:145766381-145766403 GTGTAGAAAGAGGTAGACATGGG - Intronic
914467933 1:147949147-147949169 GTGTGGAAAGAGGTAGACCCGGG - Intronic
914961607 1:152214152-152214174 ATGTAGAACCATGTTGCCCATGG + Exonic
914962102 1:152216972-152216994 ATGTAGAACCATGTTGCCCATGG + Exonic
914962594 1:152219780-152219802 ATGTAGAACCATGTTGCCCATGG + Exonic
915208492 1:154288019-154288041 GTGTAGAAAGAGGTAGACATGGG + Intergenic
915426981 1:155835085-155835107 GTGTAGAAATAGGTAGACATGGG + Intronic
915891068 1:159774406-159774428 GTGTGAAAAAAGGTTGTCCATGG + Intergenic
916105113 1:161423907-161423929 GTGTAGAAAGAGGTAGACGTGGG + Intergenic
916755437 1:167765216-167765238 TAGGAGAAACAGGTTGGCCATGG + Intronic
917375497 1:174348845-174348867 GTGTAGAAAGAGGTAGACATGGG - Intronic
917860193 1:179136317-179136339 GTGTAGAAAGAGGTAGACATGGG + Intronic
918221118 1:182437333-182437355 GAGTAGAAACATGTTGAAAAAGG + Intergenic
918254961 1:182740941-182740963 GTGTAGAAAGAGGTAGACATGGG - Intergenic
919925733 1:202191209-202191231 GTGTAGAAAGAGGTAGACATGGG - Intergenic
920152100 1:203918952-203918974 GTGTAGAAAGAGGTAGACATGGG - Intergenic
921142279 1:212320332-212320354 GTGTAGAAAGAGGTAGACATGGG - Intronic
921638243 1:217523560-217523582 GTGTAGAAAGAGGTAGACATGGG - Intronic
922503676 1:226114686-226114708 GTGTAGAAAGAGGTAGACATGGG - Intergenic
923268223 1:232332694-232332716 GTGTAGAAAGAGGTAGACATGGG + Intergenic
923732545 1:236566738-236566760 GTGTATCAACAAGTTGAACAAGG + Exonic
924119090 1:240778359-240778381 GTGTAAAGACAGGTTGATTATGG - Intronic
924788457 1:247220854-247220876 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1062932306 10:1361267-1361289 GTGTAGAAACAGGGTGAAAAAGG + Intronic
1063034458 10:2271717-2271739 GAGTAGACACAGCTTGGCCAAGG + Intergenic
1063905634 10:10777599-10777621 GTGGGGAGACAAGTTGACCAAGG - Intergenic
1066203051 10:33160301-33160323 GTGGAGAAACAGGTCAAGCACGG - Intergenic
1066437293 10:35406616-35406638 GTGTAGAAAGAGGTAGACATGGG - Intronic
1067026644 10:42847943-42847965 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1067339925 10:45392315-45392337 GTGTAGAAAGAGGTAGACATGGG + Intronic
1067364254 10:45610422-45610444 GTGTAGAAACAGGTTGTAAAGGG + Intergenic
1068668150 10:59697340-59697362 GTGTAGAAAGAGGTAGACATGGG + Intronic
1069365900 10:67692347-67692369 GTGTAGAAAGAGGTAGACATGGG + Intronic
1069698851 10:70407501-70407523 GTGTAGAAAGAGGTGGACATGGG - Intronic
1069928717 10:71869045-71869067 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1069929916 10:71875533-71875555 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1070135602 10:73690215-73690237 GTGTAGAAAGAGGTAGACATGGG + Intronic
1070457755 10:76633828-76633850 GTGTGGAAACTGGATGACCCTGG + Intergenic
1070683938 10:78468315-78468337 GTGTAGAAAGAGGTAGACGTGGG - Intergenic
1070966859 10:80535171-80535193 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1071489026 10:86123434-86123456 GTGTGGAAACAGGCAGACAAAGG + Intronic
1072291853 10:93971218-93971240 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1072433607 10:95395847-95395869 ATTTAGAAACAGTTTGAACAGGG + Intronic
1072554308 10:96503065-96503087 GTGTAGAAGCAGGTTTCTCATGG - Intronic
1072757873 10:98032321-98032343 CTGAAGAAACAGGTTGACATTGG - Intergenic
1072830322 10:98650666-98650688 GTGTAAAAACACAGTGACCAAGG + Intronic
1073865697 10:107801140-107801162 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1074151858 10:110766712-110766734 GTGTAGAAAGAGGTAGACATGGG - Intronic
1074588237 10:114787937-114787959 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1075136840 10:119794406-119794428 GTGTAGAAAGAGGTAGACGTGGG - Intronic
1075181317 10:120214852-120214874 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1075407172 10:122203046-122203068 GTGTAGAAAGAGGTAGACATGGG - Intronic
1075842871 10:125518795-125518817 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1079020884 11:16907871-16907893 GTGTAGAAAGAGGTAGACATGGG + Intronic
1079371741 11:19859527-19859549 GTGTAGAAAGAGGTAGACATGGG - Intronic
1080790162 11:35515366-35515388 GTGTAGAAATATGTTGAGCCAGG + Intronic
1080860418 11:36145613-36145635 GTGTAGAAAGAGGTAGACATGGG + Intronic
1080983010 11:37430848-37430870 GTGTAGAAACAAGTAGACATAGG - Intergenic
1081950070 11:47037773-47037795 GTGTAGAAAGAGGTAGACGTGGG - Intronic
1082681505 11:56177465-56177487 GTGTATCAACAGGTTTAACATGG - Exonic
1083036746 11:59645167-59645189 GTGTAGAAAGAGGTAGACATGGG - Intronic
1083739813 11:64702408-64702430 GTGTAGAAAGAGGTAGACATGGG + Intronic
1083865816 11:65452079-65452101 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1084186874 11:67477817-67477839 GTGTAGAAACAAGTAGACATGGG - Intergenic
1084745420 11:71167175-71167197 GTGTAGAAAGAGGTAGACGTGGG - Intronic
1084912354 11:72401037-72401059 ATGAAGAAACAGGCTGTCCATGG + Intronic
1085111805 11:73896685-73896707 GTGTAGAAAGAGGTAGACATGGG - Intronic
1085448886 11:76619451-76619473 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1085685325 11:78616631-78616653 GTTTAGAGACAGGGTCACCAAGG + Intergenic
1085822175 11:79804674-79804696 GTGTAGAAAGAAGTTGACATAGG + Intergenic
1086017369 11:82182471-82182493 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1086396773 11:86423306-86423328 GTGTAGAAATAGCTGGACAAGGG - Intergenic
1086447175 11:86880053-86880075 GTGTAGAAAGAGGTAGACACGGG + Intronic
1086792987 11:91064096-91064118 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1087002394 11:93434109-93434131 GTGGTGCAACAGGTTGACCATGG - Intronic
1088061822 11:105662320-105662342 GTTTAGAAACAGGCAGACCTAGG - Intronic
1088658800 11:112026701-112026723 GTGTAGAAAGAGGTAGACATGGG - Intronic
1089264660 11:117251001-117251023 GTGTAGAAAGAGGTAGACATGGG - Intronic
1090441433 11:126728399-126728421 GTGTTAAAGCATGTTGACCATGG + Intronic
1090785425 11:130044013-130044035 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1091309115 11:134560374-134560396 GTGTAGCAGCAGGTTGTCCTGGG + Intergenic
1092402069 12:8184959-8184981 GTGTAGAAAGAGGTAGACGTGGG + Intronic
1092667725 12:10822905-10822927 ATGTAGAAACATGTTAACAATGG + Intergenic
1092722814 12:11458612-11458634 GTGTAGAAAGAAGTTGACATAGG + Intronic
1093453413 12:19340560-19340582 GTGTAGAAAGAGGTAGACATGGG + Intronic
1094238868 12:28200661-28200683 GTGTAGAAAGAGGTAGACATGGG - Intronic
1094520353 12:31180630-31180652 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1096064084 12:48725173-48725195 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1096082672 12:48842905-48842927 GTGTAGAAAGAGGTAGACATGGG + Intronic
1096167174 12:49436029-49436051 GTGTAGAAAGAGGTAGACATGGG - Intronic
1096441307 12:51645563-51645585 GTGTAGAAAGAGGTAGACATGGG + Intronic
1096557167 12:52410298-52410320 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1097149286 12:56964131-56964153 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1097230304 12:57507238-57507260 GTGTAGAAAGAGGTAGACATGGG - Intronic
1097249217 12:57623196-57623218 GTGGAGAAACAGGTGGAAGATGG + Intronic
1098242663 12:68484524-68484546 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1098884082 12:75942720-75942742 GTGTAGAAAGAGGTAGACACGGG + Intergenic
1099255159 12:80307194-80307216 GTGTAGAAAGAGGTAGACATGGG - Intronic
1100091306 12:90974711-90974733 GTCTGGAAACAGGAAGACCAAGG + Intronic
1100191086 12:92192508-92192530 GTGTAGAAAGAGTCTAACCATGG - Intergenic
1100269366 12:93009458-93009480 ATTTAGAAACAGTTTGACAATGG - Intergenic
1100507322 12:95235044-95235066 GTGTAGAAAGAGGTAGACATGGG - Intronic
1100577468 12:95907210-95907232 GTGTAGAAAGAGGTAGACATGGG - Intronic
1100606847 12:96158509-96158531 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1101317721 12:103644139-103644161 GTGTAGAAAGAGGTAGACACGGG + Intronic
1102229563 12:111253118-111253140 GGGTGGAAACAGGGAGACCAGGG - Intronic
1102746865 12:115256610-115256632 ATGCAAAAACAGGTTGAGCAGGG + Intergenic
1103535949 12:121634077-121634099 GTGTAGAAAGAGGTAGACGTGGG - Intronic
1103641923 12:122358046-122358068 GTGTAGAAAGAGGTAGACATGGG + Intronic
1103682851 12:122708642-122708664 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1103776884 12:123372439-123372461 GTGTAGAAAGAAGTTGACATAGG + Intergenic
1104861367 12:131926122-131926144 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1105980224 13:25512267-25512289 GTGTAGAAAGAGGTAGACATGGG - Intronic
1106495490 13:30270529-30270551 GTGTAGAAAGAGGTAGACATGGG + Intronic
1106559871 13:30838970-30838992 GTGTAGAAAGAGGTAGACGTGGG - Intergenic
1107493479 13:40901503-40901525 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1107499231 13:40956180-40956202 GTGTAGAAAGAGGTAGACGTGGG + Intronic
1107588725 13:41881451-41881473 GTGTAGAAAGAGGTAGACATGGG - Intronic
1108610667 13:52080499-52080521 GTGTAGAAAGAGGTAGACATGGG + Intronic
1109338784 13:61027727-61027749 GTGTTGATACATGTTGGCCAGGG + Intergenic
1112322828 13:98422654-98422676 GAGTAGAAACAGGTTGCTCCTGG - Intronic
1113478842 13:110606045-110606067 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1113915333 13:113867312-113867334 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1114652170 14:24292173-24292195 GTGTTGAAGCAGGTTGGCAAGGG - Exonic
1115073808 14:29361043-29361065 GTGTTGTAACAGCTAGACCAGGG + Intergenic
1115368592 14:32586335-32586357 ATTTAGAAACAGGCTGGCCATGG + Intronic
1115493841 14:33984175-33984197 GTGTAGAAAGAGGTAGACATGGG - Intronic
1115504395 14:34079395-34079417 GTGTAGAAAGAGGTAGACACGGG + Intronic
1115847392 14:37555028-37555050 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1116191377 14:41673102-41673124 GTGTAGAAAGAGGTAGACATGGG - Intronic
1116502389 14:45636048-45636070 GTGTAGAAAGAAGTTGACATAGG + Intergenic
1117411586 14:55456082-55456104 GTGTAGAAAGAGGTAGACATGGG - Intronic
1117553231 14:56857111-56857133 GGGTAGATACAGGTCTACCACGG + Intergenic
1119797975 14:77416589-77416611 GTGTAGAAAGAGGTAGACATGGG - Intronic
1120547494 14:85829547-85829569 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1120893137 14:89506733-89506755 GTGTAGAAAGAGGTAGACACGGG + Intronic
1121171097 14:91855084-91855106 ATGAAGAAACAAGTTGAGCAGGG + Intronic
1121531693 14:94658491-94658513 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1121564846 14:94901594-94901616 GTGCAGAAACAAGATGCCCATGG + Intergenic
1121713847 14:96058847-96058869 GGGTAGCCACAGGTTGCCCAAGG + Intronic
1122212489 14:100181537-100181559 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1122238354 14:100345279-100345301 GTGTAGAAAGAGGTAGACATGGG + Intronic
1125017099 15:34947118-34947140 GTGTAGAAAGAGGTAGACATGGG + Intronic
1125032062 15:35083029-35083051 GTGTAGAAAGAAGTTGACATAGG + Intergenic
1125493428 15:40166707-40166729 TTGAAGAAACTGGTTTACCAAGG + Intronic
1125847773 15:42873914-42873936 GTGGAGAAAGAGGTAGAACATGG - Intronic
1125877880 15:43166923-43166945 GTGTAGAAAGAGGTAGACATGGG - Intronic
1126516896 15:49549706-49549728 GTGTAGAAAGAGGTAGACATGGG - Intronic
1126692028 15:51294929-51294951 GTGTAGAAAGAGGTAGACATGGG + Intronic
1126751834 15:51885675-51885697 GTGTAGAAAGAGGTGGACATAGG - Intronic
1126799554 15:52286548-52286570 GTGTAGAAAGAGGTAGACATGGG + Intronic
1127006156 15:54572149-54572171 GTTTAGATACATGTTGACCCGGG - Intronic
1127073379 15:55304070-55304092 GTGTAGAAAGAGGTAGACATGGG + Intronic
1127154667 15:56111255-56111277 GTGTAGAAAGAGGTAGACATGGG + Intronic
1127782773 15:62331961-62331983 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1128502320 15:68235242-68235264 GTGTAGTCACAGGTGGACCTGGG + Intronic
1128586756 15:68859285-68859307 GTGTAGAAAGAGGTAGACATGGG - Intronic
1128597225 15:68964062-68964084 GTGTAGAAAGAGGTAGACATGGG - Intronic
1128642551 15:69350350-69350372 GTGTAAGAACAGGCTGAACATGG + Intronic
1129313907 15:74729427-74729449 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1129341222 15:74888187-74888209 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1129812237 15:78520625-78520647 GTGTAGAAAGAAGTAGACCTGGG - Intronic
1130381569 15:83376527-83376549 GTATAGAAACAGAAAGACCAAGG - Intergenic
1130428102 15:83821629-83821651 GTGTAGAAAGAGGTAGACATGGG - Intronic
1131459320 15:92607160-92607182 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1131479164 15:92767859-92767881 GTGTAGAAAGAGGTAGACATGGG - Intronic
1132300674 15:100773929-100773951 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1132894085 16:2219722-2219744 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1132921736 16:2399698-2399720 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1132992136 16:2801727-2801749 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1133680514 16:8115530-8115552 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1133889496 16:9865780-9865802 GTGCAGAAACAGCTTGCCCTTGG - Intronic
1134082580 16:11335471-11335493 GTGTAGAAAGAGGTAGACATGGG - Intronic
1135617415 16:23923786-23923808 GTGTCAAAACAGGTTGATTATGG - Intronic
1136593814 16:31233027-31233049 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1137304107 16:47181790-47181812 GTGTAGAAAGAGGTAGACATGGG + Intronic
1138028399 16:53539867-53539889 GTGTAGAAAGAGGTGGACATGGG + Intergenic
1138045090 16:53713893-53713915 GAGTAGAAAGATGATGACCAGGG - Intronic
1138466956 16:57200292-57200314 GTGTAGAAAGAGGTAGACATGGG - Intronic
1138642061 16:58395718-58395740 GTGTAGAAACAAGTAGACGTGGG - Intronic
1138876832 16:60961709-60961731 GTGTAGAAACTGTATGACAAGGG + Intergenic
1139623052 16:68163124-68163146 GTGTAGAAAGAGGTAGACATGGG - Intronic
1140506080 16:75473750-75473772 TTGTAGAGATAGGATGACCAAGG - Exonic
1141670905 16:85491262-85491284 GTGAAGAAACAGATTGATCCTGG - Intergenic
1142629540 17:1215784-1215806 GTGTAGAAAGAGGTGGACATAGG + Intronic
1142634175 17:1246910-1246932 GTGTAGAAAGAGGTAGACACGGG - Intergenic
1142657329 17:1403032-1403054 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1142825585 17:2507734-2507756 GTGTAGAAAGAGGTAGACATGGG + Intronic
1142939502 17:3371003-3371025 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1144510164 17:15867979-15868001 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1144559678 17:16311844-16311866 GTGTAGAAGGAGGTAGACCTGGG - Intronic
1144583808 17:16475754-16475776 TTGTAGAAACGGGCTGAGCACGG + Intronic
1144860565 17:18298661-18298683 GTGTAGAAAGAGGTAGACGTGGG + Intronic
1145022416 17:19442016-19442038 GTGTAGAAAGAGGTAGACACAGG + Intergenic
1145174321 17:20685697-20685719 GTGTAGAAAGAGGTAGACGTGGG + Intergenic
1147005227 17:37397808-37397830 GTGTAGCAACAGGTGCACCTTGG + Intronic
1147172958 17:38631877-38631899 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1147852518 17:43452799-43452821 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1148016519 17:44525352-44525374 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1148404513 17:47398469-47398491 GTGTAGAAAGAGGTAGACATGGG + Intronic
1148406648 17:47421252-47421274 GTGTAGAAAGAGGTAGACATGGG + Intronic
1148636157 17:49150530-49150552 GTGTAGAAAGAGGTAGACGTGGG + Intronic
1150056367 17:62021075-62021097 GTGTAGAAAGAGGTAGACATGGG - Intronic
1150214180 17:63457286-63457308 GTGTAGAAAGAGGTAGACGTGGG + Intergenic
1152824135 17:82453585-82453607 GTGTAGAAAGAAGCAGACCAAGG - Intergenic
1153605270 18:6827074-6827096 GTGTAGAAAGAGGTAGACACGGG - Intronic
1154440142 18:14382562-14382584 GTGTAGAAAGAGGTAGACGTGGG - Intergenic
1156371053 18:36471434-36471456 CTGTGGACACAGGGTGACCAAGG - Intronic
1156735361 18:40251472-40251494 ATGTAGAAACAGCTTTACAATGG + Intergenic
1158459121 18:57632465-57632487 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1159054371 18:63450158-63450180 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1160108390 18:76001517-76001539 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1160182308 18:76646061-76646083 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1160228293 18:77028377-77028399 GTGTAGAAAGAGGTAGACATGGG - Intronic
1160916408 19:1499000-1499022 GTGTAGAAAGAGGTAGACACGGG - Intergenic
1161790409 19:6356079-6356101 GTGTAGAAAGAGGTAGACACGGG + Intergenic
1163143265 19:15363765-15363787 GTGTAGAAAGAGGTAGACGTGGG + Intronic
1163542495 19:17919099-17919121 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1163558342 19:18005377-18005399 GTGTAGAAAGAGGTAGACATGGG - Intronic
1163906366 19:20152418-20152440 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1163921863 19:20296822-20296844 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1164071918 19:21776257-21776279 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1164218748 19:23173625-23173647 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1164261011 19:23568584-23568606 GTGTAGAAAGAAGTTGACATAGG + Intronic
1164298313 19:23936844-23936866 GTGTAGAAAGAGGTAGACATGGG - Intronic
1165230217 19:34382034-34382056 CTGTAGCAACAGGTGGTCCATGG + Intronic
1166425635 19:42676179-42676201 GTGTAGAAAGAGGTAGACATGGG - Intronic
1166832942 19:45648817-45648839 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1167823810 19:51953255-51953277 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1167897384 19:52593166-52593188 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1167980221 19:53269773-53269795 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1168114547 19:54214665-54214687 GTGTAGAAAGAGGTAGACATGGG - Intronic
1168695888 19:58404620-58404642 GTGTAGAAAGAGGTAGACGTGGG - Intronic
925373627 2:3365863-3365885 GTGTAGAAAGAGGTAGACATGGG - Intronic
925776134 2:7338094-7338116 GTGTAGAAAGAGGTAGACATGGG - Intergenic
927633007 2:24790674-24790696 GTGGAGTAACAGCTTTACCAAGG + Intronic
927747505 2:25634664-25634686 GTGTAGAAAGAGGTAGACATGGG + Intronic
927757727 2:25723022-25723044 GTGTAGAAAGAGGTAGACATGGG - Intergenic
927776786 2:25910102-25910124 GTGTAGAAAGAGGTAGACATGGG - Intergenic
927832980 2:26370245-26370267 GTGTAGAAAGAGGTAGACATGGG - Intronic
929061839 2:37932449-37932471 GTGTAGAAAGAGGTAGACATGGG - Intronic
929110857 2:38403988-38404010 GTGTAGAAAGAGGTAGACACGGG + Intergenic
929714985 2:44301116-44301138 CGGCAGATACAGGTTGACCACGG + Exonic
930079025 2:47432801-47432823 GTGTAGAAAGAGGTAGACGTGGG - Intronic
930821613 2:55651382-55651404 GTGTAGAAAGAGGTAGACGTGGG + Intronic
930827192 2:55706019-55706041 GTGTAGAAAGAGGTAGACATGGG + Intergenic
931582653 2:63793766-63793788 GTGTAGACATAGGTTTACCCTGG - Intronic
931783423 2:65600341-65600363 GTGTAGAAAGAGGTAGACATGGG - Intergenic
932253766 2:70266850-70266872 GTGTAGAAAGAGGTGGACATAGG - Intronic
932367424 2:71161687-71161709 GTGTAGAAAGAGGTAGACATGGG + Intergenic
932710533 2:74060901-74060923 GTGTAGAAAGAGGTAGACATGGG - Intronic
932769746 2:74493939-74493961 GTGGAGAAACAGAGTGGCCAAGG - Exonic
932807250 2:74795475-74795497 GTGTAGAAAGAGGTAGACATGGG - Intergenic
933735275 2:85488659-85488681 GTGTAGAAAGAGGTAGACATGGG + Intergenic
934704833 2:96470144-96470166 ATGGAGAGACAGGTTGGCCAGGG + Intergenic
935636307 2:105251751-105251773 GTGTAGAAAGAGGTAGACATGGG + Intergenic
937299647 2:120831402-120831424 GTGTGGGGACAGGTTGTCCAGGG + Intronic
937437783 2:121893380-121893402 GTGTAGAAAGAGGTAGACGTGGG + Intergenic
938028580 2:127972188-127972210 GTGCAGAAATAGGGTGAGCAGGG - Intronic
938720800 2:134064577-134064599 GTGTAGAAAGAGGTAGACATGGG + Intergenic
938891124 2:135706764-135706786 GTGTAGAAAGAGGTAGACATGGG - Intronic
939186917 2:138872092-138872114 GTGTAGAAATAGGTAGACATGGG - Intergenic
940299374 2:152161105-152161127 GTGTAGAAAGAGGTAGACATGGG + Intronic
941023784 2:160438646-160438668 GTGTAGAAAGAGGTAGACATGGG - Intronic
941847988 2:170150512-170150534 GTGTAGAAAGAGGTAGACATGGG + Intergenic
942020786 2:171866219-171866241 GTGTAGAAAGAGGTAGACATGGG - Intronic
942024899 2:171900564-171900586 GTGTAGAAAGAGGTAGACATGGG + Intronic
942096438 2:172538669-172538691 GTGTAGAAAGAAGTAGACAAGGG + Intergenic
943412029 2:187557518-187557540 GTGTAGAAAGAGGTAGACATGGG + Intronic
944255493 2:197619350-197619372 GTGTAGAAAGAGGTAGACATGGG + Intronic
944785527 2:203066462-203066484 GTGTAGAAAGAAGTTGACATAGG - Intronic
945813908 2:214580493-214580515 GTCTAGAAAGAAGTTTACCATGG - Intergenic
946318359 2:218932208-218932230 GTGTAGAAAGAGGTAGACATGGG + Intergenic
948651571 2:239449325-239449347 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1169718393 20:8644935-8644957 GTGTAGAAAGAGGTAGACATGGG + Intronic
1170276294 20:14594180-14594202 GTGAAGAACCAGGTTGAAGAGGG - Intronic
1170384468 20:15800796-15800818 GTGTAGAAAGAGGTAGACATGGG + Intronic
1170677403 20:18495195-18495217 GTGTAGAAAGAGGTAGACATGGG + Intronic
1172338154 20:34133277-34133299 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1172497463 20:35398431-35398453 GAGTAGAAACAGGTTGAGGTGGG + Intronic
1172574879 20:36001124-36001146 GTGTAGAAAGAGGTAGACATGGG - Intronic
1172721402 20:37001368-37001390 GTGTAGAAAGAGGTAGACATGGG + Intronic
1172722989 20:37013196-37013218 GTGTAGAAAGAGGTAGACATGGG + Intronic
1173272900 20:41554767-41554789 GTGTAGAAAGAGGTAGACATGGG - Intronic
1173517895 20:43677912-43677934 GTGTAGAAAGAGGTAGACATGGG + Intronic
1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG + Intronic
1173708262 20:45130713-45130735 GTGTAAAACCAGGTTTACAATGG + Intergenic
1174020390 20:47525320-47525342 GTGTAGAAAGAGGTAGACATGGG - Intronic
1174218500 20:48935480-48935502 GTGTAGAAAGAGGTAGACATGGG - Intronic
1174345032 20:49922727-49922749 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1174835909 20:53854828-53854850 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1175775825 20:61653323-61653345 GTGTAGAAAGAGGTAGACATGGG - Intronic
1176348123 21:5770193-5770215 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1176354937 21:5890777-5890799 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1176496704 21:7554262-7554284 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1176542444 21:8168263-8168285 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1176561395 21:8351308-8351330 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1178075887 21:29012380-29012402 GTGTAGAAAGAGGTAGACATGGG + Intronic
1178873071 21:36392310-36392332 GTGTAGAAAGAGGTAGACATAGG - Intronic
1179625312 21:42645928-42645950 GAGGAGACACAGGTTGTCCAGGG + Intergenic
1180125276 21:45785741-45785763 GTGTAGAAAGAGGTAGACATGGG + Intronic
1181273878 22:21676744-21676766 GTGTAGAAACAAGTAGACATAGG - Intronic
1181301287 22:21883325-21883347 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1181538530 22:23560864-23560886 GTGTAGAAAGAGGTAGACACGGG - Intergenic
1181657601 22:24316665-24316687 GTGTAGAAAGAGGTAGACATGGG - Intronic
1181792220 22:25277520-25277542 GTGTAGAAAGAGGTGGACATGGG - Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182758955 22:32706596-32706618 GTGTAGAAAAAGGGAGACCATGG + Intronic
1183941123 22:41295306-41295328 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1203247383 22_KI270733v1_random:84681-84703 GTGTAGAAAGAGGTAGACATGGG - Intergenic
949288830 3:2439008-2439030 GTTGAGAAGCAGGGTGACCATGG - Intronic
949992746 3:9592352-9592374 GTGTAGAAAGAGGTAGACATGGG + Intergenic
950754550 3:15162418-15162440 GTGTAGAAAGAGGTAGACATGGG - Intergenic
950819673 3:15742983-15743005 GTGTAGAAAGAGGTAGACATGGG + Intronic
950948952 3:16979724-16979746 GTGTAGAAAGAGGTAGACATGGG - Intronic
951550364 3:23871064-23871086 GTGTAGAAAGAGGTAGACATGGG - Intronic
953307252 3:41841747-41841769 GTGTAGAAAGAAGTTGACATAGG + Intronic
954355869 3:50084033-50084055 GTGTAGAAAGAGGTAGACATGGG - Intronic
954483426 3:50823553-50823575 GTGTAGAAAGAGGTAGACATGGG - Intronic
954519373 3:51210465-51210487 GGGTTGAAACAGGTTTTCCAAGG - Intronic
954599947 3:51859259-51859281 GTGTAGAAAGAGGTAGACATGGG + Intergenic
955362739 3:58289622-58289644 GTGTAGAAAGAGGTAGACATGGG - Intronic
955699670 3:61671526-61671548 GTGTAGAAAGAGGTAGACATGGG - Intronic
955733490 3:62011989-62012011 GTGTAGAAACTTGGTGACCGTGG + Intronic
956697280 3:71929153-71929175 GTGTAGAAAGAGGTAGACACGGG + Intergenic
958560692 3:95744549-95744571 GTGTAGAAAGAGGTAGACATGGG - Intergenic
958796298 3:98709927-98709949 CTGTGGAAAATGGTTGACCAGGG - Intergenic
959586001 3:108026052-108026074 GTGTAGAAAGAGGTAGACACGGG - Intergenic
959692710 3:109217035-109217057 GTGTACAAAGACGTTGAACATGG - Intergenic
960056641 3:113280523-113280545 GAGAAGAAACAAGTTGACAATGG - Intronic
960388752 3:117051086-117051108 GTGTAGAAAGAGGTAGACATGGG + Intronic
960577647 3:119243138-119243160 GTGTAGAAAGAAGTTGACATAGG + Intergenic
961163585 3:124749780-124749802 GTGTAGAAAGAGGTAGACATGGG - Intergenic
961784038 3:129338846-129338868 GTGTAGAAAGAGGTAGACATGGG - Intergenic
961788549 3:129362086-129362108 GTGTAGAAAGAGGTAGACATGGG - Intergenic
962572451 3:136724211-136724233 GTGTAGAAAGAGGTAGACACGGG + Intronic
963451070 3:145482638-145482660 GTGTAGAAAGAGGTAGACATGGG - Intergenic
963826795 3:149964372-149964394 TTGTAGTGACATGTTGACCATGG - Intronic
964512361 3:157466838-157466860 GTGTAGAAACATATGGCCCAAGG + Intronic
964766093 3:160179190-160179212 GTGTAGAAAGAGGTAGACATGGG + Intergenic
965472144 3:169107498-169107520 GTGTAGATACAGGCTGACATGGG - Intronic
965894914 3:173563859-173563881 GTGTAGAAACTGGTTGTAGAGGG - Intronic
966014990 3:175131529-175131551 GTGTAGAAAGAGGTAGACATGGG - Intronic
966253351 3:177891465-177891487 GTGTAGAAAGAGGTAGACATGGG - Intergenic
966274346 3:178146726-178146748 GTGTGGAAACAGGTTGGAAAGGG - Intergenic
966419961 3:179727553-179727575 GTGTAGAAAGAGGTAGACGTGGG - Intronic
967524375 3:190473807-190473829 GTGTAGAAAGAGGTAGACATGGG + Intergenic
968042374 3:195599525-195599547 GTGTAGAAAGAGGTAGACATAGG - Intergenic
968226229 3:196973935-196973957 GTGTAGAAAGAGGTAGACATGGG + Intergenic
968299447 3:197602122-197602144 GTGTAGAAAGAGGTAGACATGGG - Intergenic
968429752 4:550229-550251 GTGTAGAAAGAGGTAGACATGGG - Intergenic
968436419 4:592548-592570 GTGTAGAAAGAGGTAGACATGGG + Intergenic
968924040 4:3538235-3538257 GTGTAGAAAGAGGTAGACATGGG - Intergenic
969404297 4:6978348-6978370 GTGTAGAAAGAGGTAGACATGGG + Intronic
971331167 4:25682636-25682658 GTGGTGACACAGGTTCACCAGGG + Intergenic
972288531 4:37669640-37669662 GTGTAGAAAGAGGTAGACATGGG + Intronic
973109372 4:46378266-46378288 GTGTAGAAAGAGGTAGACGTGGG + Intronic
973263504 4:48187040-48187062 GTGTAGAAAGAAGTAGACCTGGG + Intronic
973631777 4:52826414-52826436 GTGTAGAGGCAGGGAGACCAGGG - Intergenic
973784862 4:54325180-54325202 GTGTAGAAAGAGGTAGACATGGG - Intergenic
974021104 4:56693244-56693266 GTGTAGAAAGAGGTAGACATGGG - Intergenic
974076725 4:57173695-57173717 GTGTAGAAAGAGGTAGACATGGG + Intergenic
975042623 4:69762595-69762617 GTGTAGAAAGAGGTAGACATGGG + Intronic
975322188 4:73021065-73021087 ATCCAGAGACAGGTTGACCAGGG + Intergenic
975332779 4:73137307-73137329 GTGTTGAGACAGGTTAAACAGGG + Intronic
976607492 4:86996332-86996354 GTGTAGAAAGAGGTAGACATGGG + Intronic
979641341 4:123015571-123015593 GTGTAGAAAGAGGTAGACACGGG - Intronic
979734612 4:124067171-124067193 GTGTTGAGACAGGTTCACCGTGG - Intergenic
981922499 4:150100403-150100425 GTGTAGAAACAGGTTGACCAAGG + Intronic
983652471 4:170047172-170047194 GTGTAGAAAGAGGTAGACATGGG + Intergenic
984004649 4:174294430-174294452 GTGTAGAAAGAGGTAGACACGGG - Intronic
984038009 4:174692547-174692569 GTGTAGAAAGAGGTAGACATGGG + Intronic
984455279 4:179958605-179958627 GTTTAGAAATAAGTTGACAAAGG - Intergenic
984728026 4:183040505-183040527 GTGTAGAAAGAGGTAGACATGGG - Intergenic
984977006 4:185240153-185240175 GTGTAGAAAGAGGTAGACATGGG - Intronic
985736705 5:1586911-1586933 GTGTAGAAAGAGGTAGACATGGG + Intergenic
987267817 5:16276565-16276587 GTGTAGAAAGAGGTAGACATGGG - Intergenic
988544575 5:32143058-32143080 GTGTAGAAAGAGGTAGACATGGG + Intronic
989021316 5:37012852-37012874 GTGTAGAAAGAGGTAGACATGGG - Intronic
989075653 5:37562834-37562856 GTGTAGAAAGAGGTAGACATGGG - Intronic
989211203 5:38861505-38861527 GTGTAGAAAGAGGTAGACATGGG - Intronic
989634997 5:43522686-43522708 GTGTAGAAAGAGGTAGACATGGG + Intergenic
990498715 5:56373083-56373105 GTGTAGAAAGAGGTAGACATGGG + Intergenic
990514389 5:56518233-56518255 GAGTAGAAAGAGGCTGACAAAGG - Intronic
990822382 5:59857200-59857222 GTGTAAACCCAGATTGACCAAGG - Intronic
990870918 5:60430929-60430951 GTGTAGAAAGAGGTAGACATGGG - Intronic
991373472 5:65940924-65940946 GTGTAGAAAGAGGTAGACACGGG + Intronic
991376871 5:65976903-65976925 GTGTAGAAAGAGGTAGACATGGG - Intronic
991597806 5:68323489-68323511 GTGTAGAAAGAGGTAGACATGGG - Intergenic
991672495 5:69062650-69062672 GTGTAGAAAGAGGTAGACATGGG - Intergenic
991907046 5:71525021-71525043 GTGTAGAAAGAGGTAGACATGGG - Intronic
992391558 5:76335808-76335830 GTGTAGAAAGAGGTAGACACGGG - Intronic
992574910 5:78097886-78097908 GTGTAGAAAGAGGTAGACATGGG + Intronic
992864498 5:80943722-80943744 GTGTAGAAAGAGGTAGACGTGGG - Intergenic
992963928 5:81982940-81982962 GTGTAGAAAGAGGTAGACATGGG - Intronic
993162609 5:84311946-84311968 GTGTAGAAAGAGGTAGACACGGG - Intronic
993496759 5:88616423-88616445 GTGTAGAAAGAGGTAGACATGGG + Intergenic
993661524 5:90642899-90642921 GTGTAGAAACTGCTTAACAAGGG - Exonic
995123408 5:108558762-108558784 GTGTAGAAAGAGGTAGACATGGG - Intergenic
995772882 5:115690852-115690874 GTGTAGAAAGAGGTAGACATGGG + Intergenic
995894982 5:117002151-117002173 GTGTAGAAAGAGGTAGACATGGG - Intergenic
995942125 5:117599364-117599386 GTGTAGAAAGAGGTAGACACGGG - Intergenic
995994612 5:118283149-118283171 GTGTAGAAAGAGGTAGACATGGG + Intergenic
997300219 5:132798208-132798230 GTGCAGAAACAGGTTGAAGAGGG - Intronic
997565146 5:134881574-134881596 GTGTAGAAAGAGGTAGACATGGG - Intronic
997874621 5:137537381-137537403 GTGTAGAAAGAGGTAGACATGGG - Intronic
998239111 5:140426903-140426925 GTGTAGAAAGAGGTAGACATGGG - Intronic
999180867 5:149669914-149669936 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1000159542 5:158583589-158583611 GTGTAGAAAGAGGTAGACACGGG + Intergenic
1000655333 5:163871714-163871736 GTGTACAAACTGGTAGCCCATGG - Intergenic
1001406874 5:171482709-171482731 GTTCAGAAACAGATTGACCAAGG - Intergenic
1001949282 5:175804931-175804953 GTATAGAAAGAGCTTGGCCAGGG - Intronic
1002658220 5:180771062-180771084 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1002838616 6:886678-886700 GTGTTCAAACAGGTTTACAATGG + Intergenic
1002885691 6:1292008-1292030 GTGTGGGAAAATGTTGACCAAGG + Intergenic
1003407206 6:5835269-5835291 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1004664023 6:17735056-17735078 GTGTAGAAAGAGGTAGACACGGG - Intergenic
1005063199 6:21796517-21796539 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1005159118 6:22837487-22837509 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1006141260 6:31931650-31931672 GTGTAGAAAGAGGTAGACCTGGG - Intronic
1006281663 6:33059337-33059359 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1006403691 6:33832327-33832349 GTGTAGAAAGAGGTAGACCTGGG - Intergenic
1007433494 6:41790463-41790485 GGATAGAAACAGGTCCACCATGG + Exonic
1008111984 6:47505415-47505437 GTGTAGAAAGAGGTAGACATGGG - Intronic
1008841433 6:55909703-55909725 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1009307542 6:62109124-62109146 TTGTATAAAAAGGTTGAACAAGG + Intronic
1009844693 6:69121391-69121413 GTGTAGAAAGAAGTTGACATAGG - Intronic
1010030182 6:71265796-71265818 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1010270794 6:73914675-73914697 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1010561819 6:77360285-77360307 GTTTAGAAGGAGGTTGATCAGGG + Intergenic
1011778134 6:90755171-90755193 GTATAGAAACAGTTTCACTACGG + Intergenic
1013190971 6:107803657-107803679 GTGTAGAAAGAGGTAGACATGGG + Intronic
1013206986 6:107954074-107954096 GTGTAGAAAGAGGTAGACACGGG + Intronic
1013244107 6:108270542-108270564 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1015221015 6:130802917-130802939 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1015277511 6:131399437-131399459 GTGTAGTAACTGGTAGAGCAAGG + Intergenic
1015643440 6:135363435-135363457 GTGTAGAAAGAGGTAGACATTGG - Intronic
1016802028 6:148178533-148178555 GTGTAGAAAGAGGTAGACGGGGG - Intergenic
1017214861 6:151898786-151898808 GTGTAGAAAGAGGTAGACGTGGG - Intronic
1017419985 6:154263632-154263654 GTGTAGAAAGAGGTAGACGTGGG - Intronic
1017660816 6:156670773-156670795 GTGTAGAAAGAGGTAGACACGGG + Intergenic
1018009992 6:159660838-159660860 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1018548508 6:164964496-164964518 CTGTAGGAACAGCTTGACCCAGG - Intergenic
1018879697 6:167864791-167864813 GTGAAGAGACAGCTTGTCCAGGG + Intronic
1020219429 7:6223442-6223464 GTGTAGAAAGAAGTTGACATAGG + Intronic
1020284509 7:6670609-6670631 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1020831902 7:13103279-13103301 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1021482280 7:21130867-21130889 ATTTAGAAGCTGGTTGACCATGG - Intergenic
1021731425 7:23598651-23598673 ATGTAGAAAAAAGTTGACCCAGG - Intronic
1022083622 7:27045754-27045776 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1022274164 7:28839133-28839155 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1022318299 7:29264421-29264443 GTGTAGAAAGAAGTAGACCTGGG + Intronic
1023044306 7:36197521-36197543 GTGTAGAAAGAGGTAGACATGGG + Intronic
1023160803 7:37293326-37293348 GTGTAGAAAGAGGTAGACATGGG + Intronic
1024199574 7:47091858-47091880 GTTTAGAAACAGGTGGCTCATGG - Intergenic
1024309979 7:47959977-47959999 GTGTAGAAAGAGGTGGACACGGG + Intronic
1024539054 7:50460657-50460679 GTGTAGAAAGAGGTAGACACAGG + Intronic
1024931069 7:54667400-54667422 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1025011341 7:55401928-55401950 GTGTAGAAAGAGGTAGACATGGG - Intronic
1025821255 7:64967316-64967338 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1026861989 7:73796976-73796998 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1028227161 7:88265867-88265889 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1028685372 7:93585609-93585631 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1030036112 7:105410392-105410414 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1032042656 7:128576397-128576419 GTGTAGAAAGAGGTAGACACGGG - Intergenic
1032291466 7:130592008-130592030 GTGTAGAAAGAGGTAGACATGGG + Intronic
1032570024 7:132986011-132986033 GTGTAGAAAGAGGTAGACATGGG + Intronic
1033114344 7:138612003-138612025 GTGTAGAAAGAGGTAGACATGGG + Intronic
1033219606 7:139519762-139519784 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1033376018 7:140762994-140763016 GTGTAGAAAGAGGTAGACATGGG - Intronic
1034361768 7:150506098-150506120 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1036506855 8:9364761-9364783 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1038695935 8:29806196-29806218 GGGTGGAAACAGGGTCACCATGG - Intergenic
1040043293 8:42939103-42939125 GTGTAGAAAGAGGTAGACATGGG - Intronic
1040785702 8:51159791-51159813 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1041362832 8:57071176-57071198 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1041513502 8:58676185-58676207 GTGTAGAAAGAGGTAGACCTGGG - Intergenic
1041676686 8:60547283-60547305 GTGTAGAAAGAGGTAGACAGGGG - Intronic
1041920645 8:63179605-63179627 GTGTAGAAAGAGGTAGACATGGG - Intronic
1042139437 8:65663138-65663160 GTGTAGAAAGAGGTAGACATGGG + Intronic
1044310128 8:90684072-90684094 GTGTAGAAAGAGGTAGACATAGG + Intronic
1045298370 8:100891858-100891880 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1045524321 8:102928940-102928962 GTGTAGAAAGAGGTAGACATGGG + Intronic
1047781856 8:128118202-128118224 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1048061393 8:130922596-130922618 GTGTAGAAAGAGGTAGACATGGG - Intronic
1049704989 8:144037425-144037447 GTGTAGAAAGAGGTAGACATGGG + Intronic
1051661732 9:19433541-19433563 GTGTAGAAAGAGGTAGACATGGG - Intronic
1052259333 9:26493581-26493603 GTGTAGAAAGAAGTTGACATAGG + Intergenic
1053095482 9:35323812-35323834 CTGTAGAAACAGGTTAGGCAAGG - Intronic
1054773391 9:69103996-69104018 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1055242314 9:74198248-74198270 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1055506746 9:76955877-76955899 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1056065172 9:82925885-82925907 GTCTAGAAAAATGTTCACCATGG - Intergenic
1056409686 9:86312720-86312742 GTGTAGAAAGAGGTAGACATGGG + Intronic
1056624614 9:88244479-88244501 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1057087729 9:92227192-92227214 GTGTAGAAAGAGGTAGACATGGG - Intronic
1057154620 9:92830451-92830473 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1058105301 9:100963720-100963742 GTGAAGAAACAGGTTCACATGGG - Intergenic
1058375544 9:104317026-104317048 GTGTAGAAAGAAGTTGACATAGG + Intergenic
1058661726 9:107272696-107272718 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1058972624 9:110097339-110097361 GTGTAGAAAGAGGTAGACATGGG - Intronic
1058999580 9:110334715-110334737 GAGGAGAAACAGGTTGGCCAGGG + Intronic
1059707685 9:116840263-116840285 GTGTAGAAAGAGGTAGACATGGG - Intronic
1060334832 9:122711547-122711569 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1060682618 9:125578039-125578061 GTGTAGAAAGAGGTAGACACGGG + Intronic
1060823260 9:126673446-126673468 GTGTAGAAAGAGGCTAACCCAGG + Intronic
1061143248 9:128780757-128780779 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1061427039 9:130506279-130506301 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1203463715 Un_GL000220v1:67741-67763 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1185585071 X:1236631-1236653 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1186097780 X:6120796-6120818 GTGTGAAAGCAGGTTGCCCAGGG + Intronic
1187184056 X:16968228-16968250 GTGTAGAAAGAGGTAGACATGGG - Intronic
1188492624 X:30753743-30753765 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1188510738 X:30933781-30933803 ATGTGGAAAAGGGTTGACCAAGG + Intronic
1189210573 X:39278618-39278640 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1189421869 X:40863263-40863285 GTGTAGAAAGAAGTTGACCTAGG + Intergenic
1189458126 X:41212069-41212091 GTGTAGAAAGAGGTAGACATGGG + Intronic
1189569893 X:42285420-42285442 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1189881997 X:45503643-45503665 GTGTAGAAAGAAGTTGACATAGG - Intergenic
1189968136 X:46395044-46395066 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1191068831 X:56379860-56379882 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1192123557 X:68479113-68479135 GTGTAGAAACAAGTAGACATAGG + Intergenic
1192352730 X:70371362-70371384 GTGTAGAAAGAGGTAGACATGGG - Intronic
1192386979 X:70680189-70680211 GTGTAGAAAGAGGTAGACGTGGG + Intronic
1193114748 X:77766076-77766098 GTGTAGAAAGAGGTAGACATGGG - Intronic
1193345102 X:80396660-80396682 GTGTAGAAAGAGGTAGACATGGG - Intronic
1193362446 X:80591853-80591875 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1193782735 X:85723624-85723646 GTGTAGAAAGAGGTAGACATGGG - Intergenic
1195010046 X:100724478-100724500 GTGTAGAAAGAGGTAGACATGGG + Intronic
1195077452 X:101340640-101340662 GTGTAGACACAGTTTTGCCATGG - Intergenic
1195353135 X:104013377-104013399 GTGCTGAAGCAGGTTCACCAGGG - Exonic
1195355961 X:104040175-104040197 GTGCTGAAGCAGGTTCACCAGGG + Exonic
1196248220 X:113426344-113426366 ATGCAGAGACAGGTAGACCATGG + Intergenic
1196778693 X:119362629-119362651 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1197199394 X:123734590-123734612 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1197453084 X:126641942-126641964 GTGTAGAAAGAAGTTGACATGGG + Intergenic
1197736330 X:129851578-129851600 GTGTAGAAAGAGGTAGACACGGG + Intergenic
1197897209 X:131327833-131327855 GTGTAGAAAGAGGTAGACATGGG + Intronic
1198476099 X:136999738-136999760 GTGTAGAAAGAGGTAGACACGGG - Intergenic
1198819385 X:140630479-140630501 GAGTAGAATCTGGTTGCCCAGGG - Intergenic
1199185674 X:144912196-144912218 TTCTAGAAACAGGGTGATCATGG - Intergenic
1199231079 X:145436734-145436756 GTGTAGAAAGAGGTAGACATGGG + Intergenic
1199256596 X:145725115-145725137 GTCTAGGAACAGGATGACTAAGG + Intergenic
1199727510 X:150599209-150599231 GTGTAGAACTAGGATGACTATGG + Intronic
1200136028 X:153875273-153875295 GTTCAGAGACAGGGTGACCAAGG + Intronic
1201335884 Y:12879159-12879181 GTGTAGAAAGAGGTAGACATGGG + Intergenic