ID: 981923849

View in Genome Browser
Species Human (GRCh38)
Location 4:150116787-150116809
Sequence GTGATGAAGGCCATGGTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 253}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981923845_981923849 -6 Left 981923845 4:150116770-150116792 CCTCTTGGTTAGCCAGGGTGATG 0: 2
1: 8
2: 27
3: 56
4: 146
Right 981923849 4:150116787-150116809 GTGATGAAGGCCATGGTGATAGG 0: 1
1: 0
2: 0
3: 20
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981923849 Original CRISPR GTGATGAAGGCCATGGTGAT AGG Intronic
900055906 1:630474-630496 GTGATGATGGCTATGATGGTGGG - Intergenic
900141541 1:1141169-1141191 GTGAGGAAGGCGTTGGGGATGGG - Intergenic
900209430 1:1446634-1446656 TTGATGATGGCCATGGCGAGGGG + Intergenic
900219249 1:1498496-1498518 TTGATGATGGCCATGGCGAGGGG + Intergenic
900898624 1:5501925-5501947 GTGGTGCAGGCCGTCGTGATGGG - Intergenic
900975183 1:6012202-6012224 GTGATGAAGGCGGAGGTGATGGG + Intronic
900975193 1:6012236-6012258 GTGATGAAGGCGGAGGTGGTGGG + Intronic
900975206 1:6012288-6012310 GTGATGAAGGCAGAGGTGGTGGG + Intronic
900975238 1:6012410-6012432 GTGATGAAGGCGGAGGTGGTGGG + Intronic
900975270 1:6012532-6012554 GTGATGAAGGCGGAGGTGGTGGG + Intronic
900975289 1:6012605-6012627 GTGATGAAGGCGGAGGTGGTGGG + Intronic
901008569 1:6184134-6184156 GTGATAAGGACCCTGGTGATGGG - Intronic
902670676 1:17971193-17971215 TGGATGAACACCATGGTGATGGG + Intergenic
903059152 1:20657397-20657419 GTGAAAGTGGCCATGGTGATGGG + Intronic
903673195 1:25048369-25048391 CTGGTGATGGCGATGGTGATGGG - Intergenic
903885153 1:26536805-26536827 GCCATGGAGGCCATGGTGGTAGG - Intronic
905534918 1:38713629-38713651 GTGATGTTGGCCATGGAGATGGG - Intergenic
905607025 1:39310407-39310429 CTGATGAAGTCCATGGAGAATGG + Exonic
906101445 1:43266317-43266339 GTGAGGATGGTCATGGTGAATGG + Intronic
906913539 1:49982694-49982716 GGGATGAAGTGCATGTTGATTGG - Intronic
909599647 1:77448288-77448310 GGGAAGAAGGGCATGCTGATTGG - Intronic
909986121 1:82162602-82162624 GTAATGAAGGCCATCTGGATAGG + Intergenic
910935962 1:92484792-92484814 GGGGTGAAGGCGATGGTGACCGG + Intronic
913409766 1:118538241-118538263 ATGAGGAAAGGCATGGTGATAGG - Intergenic
916198031 1:162243299-162243321 GTGAGGAAGGCAATGATGAGGGG + Intronic
916478897 1:165197424-165197446 ATGATGAAGGTGTTGGTGATAGG - Intergenic
917735605 1:177917231-177917253 GTGATGAAGGAAGTGGCGATTGG + Intergenic
921392876 1:214634644-214634666 GTGATGAAGACCAAGGCAATGGG - Intronic
924680212 1:246223315-246223337 CTGATGAAGGGGATGGTGGTAGG + Intronic
924766898 1:247041523-247041545 GTGATGACGGCCATGGCAAACGG + Intronic
1067151822 10:43742187-43742209 GTGATAAAAGCCATGCTGAGTGG - Intergenic
1067994519 10:51256571-51256593 GTGAAGAGGGCCATGATGTTTGG + Intronic
1070039898 10:72766109-72766131 CTGTGGAAGGCCATGGTGAGAGG - Intronic
1070706822 10:78645834-78645856 GACAAGAAGGCCATGGGGATGGG + Intergenic
1071331874 10:84568632-84568654 GTGATGTAGGCAATGGTGAGGGG - Intergenic
1072202967 10:93177627-93177649 GTGCTGAGGGCCATGGTGCTAGG + Intergenic
1074383162 10:112996507-112996529 ATGCTGAAGGCCAAGGTGAGGGG - Intronic
1076252129 10:128993424-128993446 GTGCAGGAGGGCATGGTGATTGG + Intergenic
1076866179 10:133167522-133167544 GTGTTGAAGGCCAGGGTGTCGGG - Exonic
1077947661 11:6919542-6919564 TTGATGAAAGCCATTCTGATTGG - Intergenic
1078808180 11:14727951-14727973 GTGATGAAGAGCATGCTTATAGG + Intronic
1080848226 11:36045009-36045031 GTGCTGAAGGCCATAGGGAGTGG - Intronic
1081705007 11:45177552-45177574 GTGATAAAGGCCATAGGGACAGG - Intronic
1081958047 11:47110819-47110841 GTCATGAAAGCCATGGAGGTGGG + Intronic
1083794109 11:65004724-65004746 GTGGTGCAGGGCATGGTGCTGGG - Intergenic
1084325529 11:68397639-68397661 GTGATGATGACGACGGTGATGGG - Intronic
1085555280 11:77413830-77413852 GGGATGAAGGACATGGTGTGGGG - Intronic
1087123147 11:94595607-94595629 GAGTTGGAGGCCATGCTGATAGG + Intronic
1088567616 11:111189148-111189170 GTGCTTAATGCCAGGGTGATGGG + Intergenic
1089216839 11:116839305-116839327 GTGATTAAGGACCTGGAGATGGG + Intergenic
1089245756 11:117118463-117118485 TTGGTGAAGGCCCTGGTGGTAGG - Intergenic
1089419798 11:118322936-118322958 GTGGTGAAGACCTTGGTGAAGGG + Intergenic
1091309876 11:134564835-134564857 AAGATGAAGGCCAGTGTGATAGG + Intergenic
1091727781 12:2857590-2857612 TTGATGGAGACGATGGTGATAGG - Intronic
1092057504 12:5520220-5520242 GGCATGAAGGCCATGGGGAGTGG - Intronic
1093219178 12:16398831-16398853 GTGAGGAAGGTCATGGCAATAGG + Intronic
1095225276 12:39671598-39671620 GTGATGATAGTCATGGTGGTGGG + Intronic
1096453498 12:51765995-51766017 TTTATGATGGTCATGGTGATTGG + Exonic
1096530696 12:52241140-52241162 GTGAGGGAGGCCATGGGGAATGG - Intronic
1096597727 12:52707445-52707467 GTCATGAAGGCCTTTGTTATTGG - Intergenic
1097029929 12:56082807-56082829 GTGAGGATTGCCATGGTGAAAGG + Intronic
1098250509 12:68564675-68564697 GTGATGGTGGTGATGGTGATGGG - Intergenic
1100365593 12:93917459-93917481 GGGAGGAAGGCCATGGTCTTGGG + Intergenic
1101461612 12:104902366-104902388 GTGAAGAGGGACAAGGTGATTGG + Intronic
1102176658 12:110880714-110880736 GTGATGATGGTTATAGTGATGGG + Intronic
1103934406 12:124467740-124467762 GTGATGAAGATGAGGGTGATGGG - Intronic
1104050552 12:125190968-125190990 GTGGTGATGGTGATGGTGATGGG + Intronic
1104050637 12:125191230-125191252 GTGGTGATGGTGATGGTGATGGG + Intronic
1104777070 12:131396406-131396428 CTGATGATGGTAATGGTGATGGG + Intergenic
1106999542 13:35527201-35527223 GGGAGGAAGTACATGGTGATTGG + Intronic
1109161918 13:58986033-58986055 GTGATGAAGGGCAGGGTGGGTGG - Intergenic
1109525261 13:63566641-63566663 GGGAGGAAGGGCATGCTGATTGG - Intergenic
1110014708 13:70386525-70386547 GTGAGGAAGTCCATGCTGATTGG + Intergenic
1110939455 13:81330873-81330895 GGGAAGAAGGGCATGCTGATTGG - Intergenic
1114420049 14:22574365-22574387 GTGATGAAGGCCAAGCAGAGAGG + Intronic
1116247609 14:42436210-42436232 ATGATAAATGCCATGGTGAAGGG + Intergenic
1119169593 14:72524312-72524334 ATGGTGAATCCCATGGTGATGGG + Intronic
1119729211 14:76940369-76940391 GGGATCATGGGCATGGTGATAGG - Intergenic
1120107841 14:80516573-80516595 GTGCTTTAGTCCATGGTGATGGG + Intronic
1122080820 14:99266366-99266388 GTTATTAAGGCGCTGGTGATCGG - Intronic
1122855529 14:104558294-104558316 GTGCGGAAGGCCAGGCTGATGGG - Intronic
1123058607 14:105584245-105584267 GTGAGGAAGGTGATGGTGGTGGG + Intergenic
1123082938 14:105704479-105704501 GTGAGGAAGGTGATGGTGGTGGG + Intergenic
1124420246 15:29514902-29514924 GTGTTGAAGGACATGATGAGGGG - Intronic
1124508815 15:30304909-30304931 GTGATGAGAGAAATGGTGATTGG + Intergenic
1124734743 15:32233753-32233775 GTGATGAGAGAAATGGTGATTGG - Intergenic
1125116982 15:36105713-36105735 GTGCTGCAGGCCACAGTGATTGG - Intergenic
1125515243 15:40315474-40315496 GGTCTGAAGGCCATGGTGATTGG - Intergenic
1126068775 15:44847457-44847479 GTGAAAAAGCCCATGGTGCTGGG - Intergenic
1126090051 15:45043340-45043362 GTGAAAAAGCCCATGGTGCTGGG + Exonic
1127170947 15:56300246-56300268 GTGATGATGGCCATGAGGAGAGG + Intronic
1128624004 15:69180712-69180734 GTAATGATGGCACTGGTGATGGG + Intronic
1129147229 15:73659540-73659562 GTCAAGGATGCCATGGTGATAGG - Intergenic
1130107966 15:80943170-80943192 GTGATGAGGGCCTTTGTGAGAGG - Intronic
1131793278 15:95988044-95988066 CTGAGGAAGGCCATGGCGCTGGG - Intergenic
1135004703 16:18809360-18809382 GGGTTGCAGGCCATGGTGTTGGG + Exonic
1135947172 16:26875381-26875403 GTGATGTCAGCCATGGAGATGGG - Intergenic
1136105515 16:28027279-28027301 ACGCTGCAGGCCATGGTGATTGG + Intronic
1136127338 16:28193686-28193708 GTGAGCAAGGCCAAGGTTATTGG - Intronic
1136355612 16:29743539-29743561 GTGAGGAAGGCCATGGCCAGGGG - Exonic
1138918272 16:61494874-61494896 TTGATGGAGGCCATGGAGAGTGG + Intergenic
1141391457 16:83668011-83668033 TTGATGAAGGCAAAGGTGACTGG + Intronic
1143061659 17:4207053-4207075 GTGATTAAGGACCTTGTGATGGG + Intronic
1143338999 17:6194390-6194412 GTGATGGGGGTGATGGTGATGGG + Intergenic
1143391145 17:6560009-6560031 TTTGTCAAGGCCATGGTGATTGG - Intergenic
1143446022 17:7010028-7010050 GTGACGATGGCCACAGTGATGGG + Exonic
1144063501 17:11603976-11603998 CTGGTGATAGCCATGGTGATAGG - Intronic
1144621735 17:16822613-16822635 GTGATGAAAGCCAAGGGGAATGG - Intergenic
1144658652 17:17054197-17054219 GTGATGACAGTCATGGTGGTAGG + Intronic
1144884686 17:18450101-18450123 GTGATGAAAGCCAAGGGGAATGG + Intergenic
1145147540 17:20494276-20494298 GTGATGAAAGCCAAGGGGAATGG - Intergenic
1147573721 17:41586955-41586977 GTGATGAAAGCCAAGGGGAATGG - Intergenic
1147656402 17:42093452-42093474 GTGATGAGGCCCAGGGTCATAGG - Intergenic
1148150280 17:45392995-45393017 GTGGTGAAGGAGATGGTGAGCGG + Intergenic
1150148763 17:62792868-62792890 TTGATGGAGGGGATGGTGATGGG - Intronic
1150187657 17:63201730-63201752 CTGATAAAGGCAATGCTGATTGG + Intronic
1152730583 17:81967734-81967756 GGGAGGAAGGGCATGGGGATGGG + Intergenic
1153337115 18:3936271-3936293 GTGATGAAGGCCTTGATCACTGG - Intronic
1156140541 18:34104087-34104109 TTCATGTAGGCCATGGTAATTGG + Exonic
1157627823 18:49066226-49066248 GTGGTGATGGCCAGGGAGATGGG - Intronic
1158069671 18:53456077-53456099 GTGATCAATGCCAAGGTGAGTGG + Intronic
1161781826 19:6297973-6297995 GGGAGGAAGTCCATGCTGATTGG - Intergenic
1161899394 19:7106804-7106826 ATGATGATGGTGATGGTGATAGG + Intergenic
1164924698 19:32120547-32120569 GTCTTGCAGGCCATGGTGCTGGG - Intergenic
1165953778 19:39489273-39489295 GTGAGGAGGGCCATGGGGTTTGG + Intronic
1167746507 19:51354127-51354149 GTGATGAAGGTCTTGGGGAGGGG - Intronic
926551323 2:14305043-14305065 GAGATGAAGGCCATTTTCATAGG + Intergenic
927705362 2:25293322-25293344 GGGATGAACGCCATGCTCATGGG + Intronic
929458373 2:42083102-42083124 GTGATGAAGGTCAGGGAGGTGGG - Intergenic
933658716 2:84909310-84909332 GTGATGGTGGTAATGGTGATGGG - Intergenic
934121183 2:88841456-88841478 GTGAGAACGGCCATGGTGCTAGG + Intergenic
935193459 2:100796421-100796443 GTGTTGAAGCCCAGGGTGATAGG - Intergenic
938115270 2:128598334-128598356 GTGATGATGGTGATGATGATGGG - Intergenic
941366817 2:164620624-164620646 GTGCTGAATGCTATGGAGATTGG + Intronic
941425875 2:165344879-165344901 TTCATGATGGTCATGGTGATTGG + Exonic
941482712 2:166037786-166037808 TTCATGATGGTCATGGTGATTGG - Exonic
942365079 2:175217317-175217339 GAAATGAAGGCCATCCTGATTGG + Intergenic
943117461 2:183691499-183691521 GTGGTGGTGGCCATGGGGATAGG - Intergenic
943858432 2:192828491-192828513 GGGAGGAAGGGCATGCTGATTGG - Intergenic
944657837 2:201893962-201893984 GTGATGATGGCAACAGTGATGGG + Exonic
944973063 2:205016367-205016389 GTGAAGAAGGCCAGGGTGGCTGG - Intronic
947382999 2:229563383-229563405 GTGATGATGATGATGGTGATGGG - Intronic
947383019 2:229563519-229563541 GTGATGACGATGATGGTGATGGG - Intronic
947383032 2:229563600-229563622 GTGATGATGATGATGGTGATGGG - Intronic
947383050 2:229563713-229563735 GTGATGATGATGATGGTGATGGG - Intronic
947383064 2:229563794-229563816 GTGATGATGTTGATGGTGATGGG - Intronic
947383068 2:229563817-229563839 GTGATGATGATGATGGTGATGGG - Intronic
1168859623 20:1036751-1036773 AAGAGGGAGGCCATGGTGATGGG - Intergenic
1169560486 20:6794692-6794714 GTGATTAATGCCATGGAAATAGG - Intergenic
1170624766 20:18022475-18022497 GTGATCAAGGTGTTGGTGATGGG + Intronic
1171260126 20:23724688-23724710 GTGATAACGGTGATGGTGATGGG - Intergenic
1173975612 20:47184316-47184338 GTGGTGAAGGGCATGGGGTTAGG - Intronic
1174982234 20:55408846-55408868 GTGCTTTAGCCCATGGTGATGGG + Intergenic
1175959363 20:62627398-62627420 GTGATGAGGGTGATGATGATGGG - Intergenic
1176247873 20:64105787-64105809 GTGATGATGGGCATGATGATGGG + Intergenic
1176427887 21:6559992-6560014 GGGATGATGGCCATGGGGCTGGG + Intergenic
1176872907 21:14098279-14098301 GTGATGGTGGTGATGGTGATGGG - Intergenic
1178587147 21:33880086-33880108 TTGATGATGTTCATGGTGATGGG + Intronic
1178940538 21:36901650-36901672 GTGATGATGGCCACAGAGATGGG - Intronic
1182101867 22:27663135-27663157 GTCCTGAAGGCCATGGTAAAAGG - Intergenic
1182412341 22:30197838-30197860 GTGTGGAAGGCAATGGTGATGGG - Intergenic
1182473750 22:30564576-30564598 CTGATGCAGGCCAATGTGATGGG - Intronic
1182529767 22:30946312-30946334 GTGATGCAGACCACGATGATGGG + Intronic
1183566470 22:38619064-38619086 GTGACAATGGCAATGGTGATAGG + Intronic
1184666859 22:45993878-45993900 GTGATGGAGGTTATGGTTATGGG + Intergenic
1185078806 22:48697961-48697983 GTGATGATGGTCCTGTTGATAGG + Intronic
1185226612 22:49657105-49657127 GTTAGGAAGGCCCTGGTGAGTGG - Exonic
949165164 3:931607-931629 GTGCTGATGGCCATGGAGGTGGG - Intergenic
950688221 3:14634344-14634366 GTGGGGAAGTCCATGGGGATGGG - Intergenic
951788700 3:26454353-26454375 GTGATAAAAGCCAGAGTGATAGG + Intergenic
954211727 3:49101514-49101536 CCCAGGAAGGCCATGGTGATGGG + Intronic
954746528 3:52790628-52790650 GGGATGAAGGCCATGGGGTGGGG + Intronic
955559942 3:60178178-60178200 CTGAAGAAGCCCATGGGGATTGG - Intronic
955972480 3:64449243-64449265 GTATTTAAAGCCATGGTGATGGG + Intergenic
958886104 3:99728952-99728974 GTGATGCAGGACATGGTCAGAGG - Intronic
959682834 3:109115889-109115911 GTGAGGAGGGGCATGGTGGTAGG + Intronic
960490802 3:118314423-118314445 GTGATGAAGGCAATGGGCAGAGG + Intergenic
961537984 3:127581465-127581487 GAGATGAAGCGCATGGTAATTGG + Intronic
962618606 3:137153237-137153259 GTGCTGCAGGCCACAGTGATTGG + Intergenic
963260240 3:143185066-143185088 GTCATGAAGGCCTTGATGATTGG + Intergenic
963266429 3:143244571-143244593 GTGATTAAGGCTATTGAGATGGG + Intergenic
966270882 3:178104216-178104238 GTGATTAAGATCATGGTGCTTGG + Intergenic
968590044 4:1453390-1453412 GTAATGATGGTGATGGTGATGGG - Intergenic
969234556 4:5856506-5856528 GTAATGATGGTCATGGTGATGGG - Intronic
969234575 4:5856645-5856667 GTAATGATGGTCATGGTGATGGG - Intronic
969281036 4:6170849-6170871 GTGATGGTGGTCATGGTGATGGG - Intronic
975008526 4:69321007-69321029 GTGATGAAGTTCATGCTGATTGG - Intronic
976082777 4:81375141-81375163 GTGGTGATGGCCATGGTGGGGGG - Intergenic
976387560 4:84479062-84479084 CTGATGATGACCATGGTGACTGG + Intergenic
976444156 4:85110793-85110815 GTGGTGGTGGCCATGGTGAGAGG + Intergenic
977850151 4:101817583-101817605 GTGATTAATGCCTGGGTGATTGG + Intronic
977885848 4:102250844-102250866 GTGTTGCAGGTCATGGTGAGAGG - Intergenic
978037500 4:104013810-104013832 GTGATTAAGGCAGTGGTGTTGGG - Intergenic
978380217 4:108119648-108119670 GTAATGAAGGCTATCGTGATGGG - Intronic
979504400 4:121479617-121479639 GTGGTGATGGCCATGGGGAGGGG - Intergenic
980660422 4:135850511-135850533 GTGAAGAAGGTCATGTTGCTAGG - Intergenic
980866431 4:138558537-138558559 TTGATTAAGGCCACAGTGATAGG + Intergenic
981923849 4:150116787-150116809 GTGATGAAGGCCATGGTGATAGG + Intronic
982689599 4:158532821-158532843 GTGAGGGAGGCGATGGTGAATGG - Intronic
982822362 4:159957591-159957613 GTGATGGGGGGCATGGTCATTGG + Intergenic
983752119 4:171287417-171287439 ATGTTGAAGCCCATGGTGGTAGG - Intergenic
988151940 5:27394459-27394481 GTGATGAAGGCCAAAGAAATAGG - Intergenic
988618911 5:32802515-32802537 GTGATGAAGGCCTTGTTTAGGGG - Intergenic
991094584 5:62726100-62726122 GTGAGGAGGGCCTTGGTGAAAGG + Intergenic
993056225 5:82983003-82983025 GTGATGAAGGCCATTTTAACTGG - Intergenic
993171973 5:84430935-84430957 GTGATGCAGGAAATGGTGATAGG + Intergenic
995017808 5:107331566-107331588 GTGATGATGGATATGGAGATTGG - Intergenic
995519560 5:112988718-112988740 TTGTTAAAGGCCTTGGTGATAGG + Intronic
995610887 5:113909293-113909315 GAGGTGAAGGCCATGCTGGTGGG + Intergenic
996377862 5:122833294-122833316 TTGATGAGGGCCATGAAGATAGG + Intergenic
997042796 5:130277855-130277877 GGGATGAAGTGCATGCTGATTGG + Intergenic
997341033 5:133144748-133144770 GTGAGGAGGGTCCTGGTGATGGG + Intergenic
997834614 5:137182191-137182213 CTGATGAAGGCCAGAGAGATGGG - Intronic
1001892806 5:175353262-175353284 GTCTTGGAGGCCATGCTGATGGG + Intergenic
1002347488 5:178557979-178558001 GTGATGGAGGCCATCCTGGTAGG - Intronic
1003181320 6:3794322-3794344 GTGATGACTGCCATGGGTATGGG - Intergenic
1003276951 6:4661362-4661384 TAGCTGATGGCCATGGTGATGGG - Intergenic
1003422967 6:5974464-5974486 GTGAGGAAGGCCCAGGGGATTGG - Intergenic
1003513656 6:6801740-6801762 TTGAGGGAGGCCATGGGGATGGG + Intergenic
1005565441 6:27088278-27088300 GTGATGATGGTCATGGTGGTGGG - Intergenic
1005814454 6:29539360-29539382 GTGATGAATGCAATGTTAATAGG - Intergenic
1006496148 6:34425067-34425089 GTCATGAAGGCCATGCAGGTAGG - Exonic
1007151673 6:39699246-39699268 GTGAGGAATGCCATGGTGGTTGG + Intronic
1011626753 6:89289409-89289431 AAGATTAAGGCCATGGTGTTGGG + Intronic
1013110288 6:107059563-107059585 GTAAGGAAGGCCCTAGTGATGGG - Intergenic
1013899373 6:115134755-115134777 ATGATTAATGCCATGGTGGTGGG - Intergenic
1014660145 6:124159888-124159910 TAAATGAAGGCCTTGGTGATGGG + Intronic
1017261369 6:152391505-152391527 GTGAAGAAGGCCACGGTGCTGGG - Exonic
1017720211 6:157238505-157238527 GGGATGAGGGTGATGGTGATGGG + Intergenic
1017835285 6:158171750-158171772 CTGACGAAGGACATGGTGAGGGG + Intronic
1018446275 6:163862005-163862027 GTGAAGAAAGCCATGATGTTGGG + Intergenic
1023247961 7:38226847-38226869 GTGAGGCAGGCCATGGGGACTGG - Intronic
1023499168 7:40829826-40829848 GTGATGCAGGCCCTGGAGCTAGG - Intronic
1024364726 7:48507954-48507976 GTGGTGAGGGACAGGGTGATTGG + Exonic
1024662380 7:51510798-51510820 GTGGTGGTGGCCATGGGGATAGG - Intergenic
1024825504 7:53385719-53385741 CTGATGAAGGTCATGCTGAGAGG - Intergenic
1026309407 7:69170783-69170805 GAGATGCAGCCCATGGAGATTGG + Intergenic
1031078619 7:117237676-117237698 TTGATGAAGTGCATGGTCATAGG - Intergenic
1032956134 7:136973593-136973615 GTGATGACGGTGATGGTGTTAGG + Intronic
1032956148 7:136973661-136973683 GTGATGATGGTGATGGTGTTAGG + Intronic
1035130770 7:156651016-156651038 GTGATGAACGCTATGGAGAATGG - Intronic
1036287184 8:7453385-7453407 GTTATGAAGCCCAGGGGGATAGG - Intronic
1036334297 8:7858138-7858160 GTTATGAAGCCCAGGGGGATAGG + Intronic
1037616167 8:20520587-20520609 GTGAGGATGGCCGTGTTGATGGG - Intergenic
1037699663 8:21263048-21263070 GGGATGTAGGCCAAGGAGATGGG + Intergenic
1038341170 8:26686366-26686388 GTGATGATGGATATGGTAATTGG - Intergenic
1038467473 8:27777902-27777924 GTGAGGAAGGCAATGATGAGAGG - Intronic
1039960040 8:42239291-42239313 GGGATGAGGGCCATGCTGTTGGG - Intergenic
1041184384 8:55284135-55284157 GAGATGATGGCCAAGGTGTTAGG + Intronic
1041959431 8:63595639-63595661 TTTATGAAGGTGATGGTGATTGG - Intergenic
1042060922 8:64816893-64816915 GTGATGGAGGTGGTGGTGATGGG - Intergenic
1042773171 8:72400731-72400753 GTGAAGAGAGCCATGGTGCTAGG - Intergenic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1043134177 8:76500565-76500587 GTGGTGATGGCCATGGGGAGAGG - Intergenic
1046076836 8:109322563-109322585 GTCCTGAAGGCCTTTGTGATTGG - Intronic
1046690516 8:117279406-117279428 ATGATGATTGCCATGGTTATTGG + Intergenic
1047220380 8:122913910-122913932 CTCATGAAGGCCATTGTTATAGG - Intronic
1048125464 8:131630136-131630158 CTGATCATGGCCATGGTGTTTGG - Intergenic
1050472422 9:6007591-6007613 GAGATGGAGGCGATGGTGATCGG - Exonic
1050791747 9:9480207-9480229 GAGGTGAAGGAGATGGTGATTGG + Intronic
1050886660 9:10775512-10775534 GTTATGAGGGCCATTTTGATGGG - Intergenic
1051839907 9:21383896-21383918 GAAATGAAGGTCATGGTGTTGGG - Intergenic
1052181876 9:25539081-25539103 GTGATAAAGGATATGGTGCTTGG + Intergenic
1052342519 9:27377895-27377917 GGGTTGAAGGGCAGGGTGATGGG + Intronic
1055248726 9:74277008-74277030 GTGCTGGTGACCATGGTGATGGG - Intergenic
1055982753 9:82021434-82021456 GTGATGAAGGCAGTGGAGAGTGG + Intergenic
1056719203 9:89058720-89058742 GTGGTGTAGGACATGGTGAAGGG + Intronic
1060349252 9:122843305-122843327 GTGGTGGTGGTCATGGTGATCGG - Intergenic
1186366783 X:8903506-8903528 GAAATGAAAGCAATGGTGATGGG + Intergenic
1186517863 X:10180119-10180141 GTTATCAAGGGCATGATGATGGG + Intronic
1194278872 X:91922545-91922567 GTAATGAAAGCCATGGAGAGTGG - Intronic
1197269612 X:124411381-124411403 GTGAAGGAGGCAATGGTGTTGGG + Intronic
1199531086 X:148848437-148848459 GTGATGAAGGCTTTGGTAAAAGG - Intronic
1200596351 Y:5146046-5146068 GTAATGAAAGCCATGGAGAGTGG - Intronic