ID: 981926646

View in Genome Browser
Species Human (GRCh38)
Location 4:150147718-150147740
Sequence AACTGATGCTGGAAGTATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981926640_981926646 10 Left 981926640 4:150147685-150147707 CCTGGACTTCATAGAAAGTTGCC 0: 1
1: 0
2: 0
3: 3
4: 90
Right 981926646 4:150147718-150147740 AACTGATGCTGGAAGTATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981926646 Original CRISPR AACTGATGCTGGAAGTATGC AGG Intronic
No off target data available for this crispr