ID: 981931244

View in Genome Browser
Species Human (GRCh38)
Location 4:150191338-150191360
Sequence ATTTCTGTTTGCAAGGGTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 226}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981931244_981931249 -4 Left 981931244 4:150191338-150191360 CCGATACCCTTGCAAACAGAAAT 0: 1
1: 0
2: 3
3: 14
4: 226
Right 981931249 4:150191357-150191379 AAATGACAGATTCCAGGGAGTGG 0: 1
1: 0
2: 1
3: 55
4: 431
981931244_981931253 26 Left 981931244 4:150191338-150191360 CCGATACCCTTGCAAACAGAAAT 0: 1
1: 0
2: 3
3: 14
4: 226
Right 981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG 0: 1
1: 0
2: 0
3: 1
4: 84
981931244_981931248 -9 Left 981931244 4:150191338-150191360 CCGATACCCTTGCAAACAGAAAT 0: 1
1: 0
2: 3
3: 14
4: 226
Right 981931248 4:150191352-150191374 AACAGAAATGACAGATTCCAGGG 0: 1
1: 0
2: 3
3: 43
4: 449
981931244_981931250 -1 Left 981931244 4:150191338-150191360 CCGATACCCTTGCAAACAGAAAT 0: 1
1: 0
2: 3
3: 14
4: 226
Right 981931250 4:150191360-150191382 TGACAGATTCCAGGGAGTGGTGG No data
981931244_981931247 -10 Left 981931244 4:150191338-150191360 CCGATACCCTTGCAAACAGAAAT 0: 1
1: 0
2: 3
3: 14
4: 226
Right 981931247 4:150191351-150191373 AAACAGAAATGACAGATTCCAGG 0: 1
1: 1
2: 3
3: 41
4: 485
981931244_981931254 27 Left 981931244 4:150191338-150191360 CCGATACCCTTGCAAACAGAAAT 0: 1
1: 0
2: 3
3: 14
4: 226
Right 981931254 4:150191388-150191410 AGGTTAGCAAACCTGTTCCAGGG No data
981931244_981931251 7 Left 981931244 4:150191338-150191360 CCGATACCCTTGCAAACAGAAAT 0: 1
1: 0
2: 3
3: 14
4: 226
Right 981931251 4:150191368-150191390 TCCAGGGAGTGGTGGAAGATAGG 0: 1
1: 0
2: 3
3: 25
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981931244 Original CRISPR ATTTCTGTTTGCAAGGGTAT CGG (reversed) Intronic
901010297 1:6197554-6197576 ATTTCTGTTTTCAGGCTTATAGG - Intronic
901743495 1:11357478-11357500 ATTTCTATTTGCAGGGATAGGGG - Intergenic
904966771 1:34380255-34380277 ATTTTTCTTTGCTTGGGTATGGG + Intergenic
909272296 1:73638722-73638744 AATTCTGTTGGCATGGGTATGGG + Intergenic
910649713 1:89552887-89552909 ATTGTTGTTTCCAAGGGAATTGG + Intronic
910775956 1:90875047-90875069 ATTAGTGTTTGCTAGGGAATGGG - Intergenic
910808275 1:91210473-91210495 ATTTTTGATAGGAAGGGTATGGG + Intergenic
913260992 1:116997949-116997971 ATTTCTGTTGACAAGCCTATGGG - Intergenic
913596926 1:120387277-120387299 ATCTATGTTTTCAAGGGTACAGG + Intergenic
914090340 1:144491704-144491726 ATCTATGTTTTCAAGGGTACAGG - Intergenic
914308265 1:146442518-146442540 ATCTATGTTTTCAAGGGTACAGG + Intergenic
914593842 1:149130615-149130637 ATCTATGTTTTCAAGGGTACAGG - Intergenic
915697000 1:157753529-157753551 GTTTCTGTTCCCAAGGGAATGGG + Intronic
915897992 1:159826301-159826323 TGTTCTGTTTGCAAGGATAGAGG + Intergenic
916202389 1:162284326-162284348 TTTTCTATTGGAAAGGGTATGGG + Intronic
916887848 1:169087440-169087462 GTTTCTGTTTGCTAAGGTAGAGG + Intergenic
918684911 1:187402281-187402303 AATTGTGTTTGCAATGGAATGGG - Intergenic
919401398 1:197122001-197122023 ATTTCTTTGTGCAAGGCTTTTGG - Exonic
919559158 1:199096267-199096289 ATTTTTGATAGGAAGGGTATGGG - Intergenic
1064120693 10:12615926-12615948 ATGTGTGTTTGCAAGTGTGTTGG + Intronic
1064450468 10:15437898-15437920 ATTTCTGTTTGGAATGTTTTAGG - Intergenic
1064851570 10:19714455-19714477 ATGTCTGTCTGCTAGGGTCTCGG + Intronic
1065426607 10:25611686-25611708 AATTCTGTTTGCTAGTGTTTAGG + Intergenic
1066481703 10:35802325-35802347 ATTTGTATTTTCTAGGGTATTGG + Intergenic
1067964390 10:50892934-50892956 ATTTTTGTTTGCTAGGATAATGG - Intergenic
1068720199 10:60236792-60236814 ATTGCTGTTACCCAGGGTATAGG + Intronic
1069038190 10:63667618-63667640 TCATTTGTTTGCAAGGGTATTGG - Intergenic
1069284911 10:66701758-66701780 ACTTCTGATTCCAAGTGTATTGG - Intronic
1070171528 10:73936677-73936699 ATATCTGGTTCCAAGGGTTTTGG - Intergenic
1073143678 10:101265160-101265182 ATTTCTCTGTGCCTGGGTATGGG + Intergenic
1076213350 10:128671156-128671178 ATTTCTGTTTCCTAATGTATTGG - Intergenic
1079145978 11:17852279-17852301 ATTTCTGTTTGAAAGAGCATGGG - Intronic
1079866604 11:25743431-25743453 ATTTCTGTTTGCAAATCTACAGG - Intergenic
1080337286 11:31212190-31212212 ATTTATGTTTGCAATTGTGTTGG - Intronic
1080981266 11:37409242-37409264 ATTAGTGTTTGCCAGGGTCTGGG - Intergenic
1084394487 11:68899899-68899921 ATTTCTATCTGCATGGGTGTTGG - Intronic
1087845904 11:102972011-102972033 ATTTCTGTTTGCCAATGTTTTGG - Intergenic
1093736606 12:22626410-22626432 TTTTTTGTTTGCAAGGGAAAAGG - Intronic
1094319540 12:29170364-29170386 ATTTTTGTTAGGAAGGCTATGGG + Intronic
1097308484 12:58094191-58094213 CTTTCTGCTTGCAAGGGGAATGG + Intergenic
1097367032 12:58727707-58727729 ATTCCTGGTTGAAAGTGTATGGG + Intronic
1098463687 12:70762949-70762971 ATAGCTGTTTGCAAGGGTGAAGG - Intronic
1099803216 12:87482923-87482945 AATTCTGGATGCAAGGGTATTGG + Intergenic
1099972971 12:89518683-89518705 ATTAGTGTTTGCCAGGGTCTGGG - Intronic
1101010575 12:100445138-100445160 CTTTCTGTTGGCAAGACTATGGG - Intergenic
1101511024 12:105392470-105392492 TTTTCTGTTTGCAAGGAAGTGGG + Intronic
1102838642 12:116093205-116093227 ATTTCTGTTTTCTAAGGTCTAGG - Intronic
1105534316 13:21250027-21250049 GTTTCTGTTTTAAAGAGTATTGG - Intergenic
1108012187 13:46028336-46028358 ATTTCTCTTTGCAATTTTATCGG - Intronic
1108886796 13:55195729-55195751 ATTTCTTTCTGCAGGGGTTTTGG + Intergenic
1109066101 13:57694248-57694270 AGTTCTGTTTGCAACAGTTTTGG + Intronic
1109518101 13:63470521-63470543 ATTTCTCTTTTCAAGGATACAGG + Intergenic
1110998487 13:82144841-82144863 ATTACTGTATCCAAGGGAATGGG + Intergenic
1111044288 13:82794779-82794801 ACCTCTATTTACAAGGGTATTGG + Intergenic
1112420102 13:99240900-99240922 ATTTCTGTTGGCAAGAGCACAGG + Intronic
1114662643 14:24357664-24357686 ATTTTTGTTTCCAATGGCATTGG + Intergenic
1116544977 14:46153863-46153885 AATTCTGTTTGCAAGAGAATAGG + Intergenic
1116879781 14:50154018-50154040 ATCTCTCTTTGCAAGGTTATAGG - Intronic
1116952081 14:50888038-50888060 ATATATGTTTGAAAGGATATGGG - Intronic
1117142725 14:52806264-52806286 ATCTCAGTTAGCAAGGGTGTGGG - Intergenic
1119310931 14:73645575-73645597 ATTTCAGTATGCATAGGTATGGG + Intronic
1125389569 15:39177569-39177591 ATGTCAGTTTGAAAGGGCATAGG - Intergenic
1127460750 15:59196594-59196616 TTTTCTGTTTTCATGGGTTTGGG + Intronic
1128486652 15:68097960-68097982 ATTTTTGTTTACATGAGTATAGG + Intronic
1131838364 15:96412235-96412257 CTTTCTTTTTGCGAGGGTGTGGG - Intergenic
1132165754 15:99587788-99587810 AGTGGAGTTTGCAAGGGTATAGG - Intronic
1132956534 16:2597294-2597316 ATTTCTGTGTGCAGGGTAATGGG + Intronic
1133922824 16:10169345-10169367 GCTTCTGTTAGCAAGGGTGTGGG - Intronic
1136394982 16:29987704-29987726 AGCTCTGTTGGCAAGGGTCTGGG + Exonic
1137353742 16:47737890-47737912 ATTTCTCATTGGAAGAGTATAGG + Intergenic
1139035742 16:62944167-62944189 ATTTCCTTTTGCAAAGCTATGGG + Intergenic
1140740315 16:77935858-77935880 ATACCTGTTTGCAGGGCTATTGG + Intronic
1143713587 17:8751480-8751502 ATTTCTATTTGCAAGAATGTAGG + Intergenic
1145721457 17:27076984-27077006 ATTTGTGTTTGGAATGTTATTGG + Intergenic
1148327385 17:46791070-46791092 AGTTCTGTCTGCAAAGGTACAGG + Intronic
1150187596 17:63200922-63200944 ATCTCTGCTTTCAAGGGTAGAGG - Exonic
1150908494 17:69363538-69363560 ATTTCTGTTGGCAAGGGCATAGG - Intergenic
1151232009 17:72691783-72691805 CTTTATGTTTGCAAGGTTCTGGG - Intronic
1151513781 17:74579247-74579269 TTTTCTGTTTTCATGGGTTTAGG + Intergenic
1155926196 18:31658305-31658327 ATGTCTGTGTGCAAGGATAAGGG - Intronic
1156100968 18:33594289-33594311 ATTTCTTTTTTCAAAGGGATGGG + Intronic
1156898040 18:42269191-42269213 TTTTCTCTTTCCAAGGATATTGG + Intergenic
1159543172 18:69805999-69806021 ATTTCTGCTTGAAAAAGTATAGG + Intronic
1165066178 19:33229858-33229880 ATTTCTGATTGCAAGTTTGTGGG - Intergenic
1166376477 19:42330296-42330318 ATTTCTGTCTGGAGTGGTATGGG + Intronic
925605621 2:5656647-5656669 ATCTATGTTTTCAAGGGTACAGG + Intergenic
926896675 2:17698109-17698131 ATTTGTTTTTGCCAGGGGATGGG + Intronic
927147259 2:20174379-20174401 ATTTCTTTTTGCAGGGGAAAGGG - Intergenic
927272882 2:21232245-21232267 GTTTCTGTTTGCAAGTGTCTGGG - Intergenic
927323552 2:21776495-21776517 TATTTTGTTTGCAAGGGTATTGG + Intergenic
929854102 2:45621356-45621378 TATACTGTTTGCAAGGGTGTGGG + Intergenic
932950187 2:76283619-76283641 ATTTTTGTCTGCAAGAGAATGGG - Intergenic
933187094 2:79290531-79290553 GTCTCTGTTTGCTAGGGTCTTGG - Intronic
934497186 2:94814877-94814899 ATTAATGTTTGCAAGGGGCTGGG - Intergenic
934569877 2:95362563-95362585 ATTTCTGTTTACTAGTGCATAGG - Intronic
935048258 2:99501239-99501261 AATTCTGTGTGCAAACGTATTGG + Intergenic
937530682 2:122823613-122823635 ATTTCTGTTTTCAAAGGCTTTGG - Intergenic
938118138 2:128615921-128615943 ATTCCTGATTGCAGGGGTCTGGG + Intergenic
938868427 2:135449241-135449263 ATTTCTCATTGCAATTGTATTGG - Intronic
940364479 2:152832604-152832626 AAATCTGTTGACAAGGGTATGGG + Intergenic
940636607 2:156305669-156305691 ATTTCTGTAAGAAATGGTATTGG - Intergenic
941981533 2:171463251-171463273 AATTCTTTTTGCACTGGTATAGG + Intronic
942434434 2:175956377-175956399 ATTTCTGGTTGCAAAGTTATAGG - Intronic
943928944 2:193824622-193824644 ATTTCTGTCTGCCAGGATGTAGG - Intergenic
945575108 2:211521010-211521032 ATTTCTGTATGTCAGGGGATAGG - Intronic
947345251 2:229183712-229183734 ATTTCTGCTTCCCAGGGTTTTGG + Intronic
948448498 2:238052717-238052739 TTTACTGGTTGCTAGGGTATGGG + Intronic
1171942139 20:31341170-31341192 ATTTCTCTTTGTAGGGATATAGG - Intergenic
1172947119 20:38698094-38698116 GTTTCTTTTTGCCAGTGTATAGG + Intergenic
1173438625 20:43055544-43055566 ATTTCTGTTTGCTAGAGCAGTGG - Intronic
1173607511 20:44342139-44342161 ATTTCTTTTTGCAATTTTATAGG - Intronic
1174199701 20:48798599-48798621 ACTTCAGTTTGCAAGCGCATGGG - Intronic
1174260146 20:49288410-49288432 ATTTCTGTTTTTAAGAGAATGGG + Intergenic
1175149727 20:56924133-56924155 ATTTCTGTTTTCAAAGGTTATGG - Intergenic
1175689162 20:61053213-61053235 CTTTCTGTTTCCAAGGCTTTAGG - Intergenic
1175976386 20:62712431-62712453 ATTTCTGTTTGCAAGTGCCCAGG - Intronic
1176987041 21:15449168-15449190 ATCTGTGTTTGCCAGGGTATAGG - Intergenic
1177572599 21:22906308-22906330 TTTCCTGTTTGCAAAGGTTTGGG + Intergenic
1177974714 21:27833089-27833111 ATAAATGTTTGCAAGTGTATGGG - Intergenic
1178890262 21:36515042-36515064 CTTGCTGTTTTCAAGGGTTTTGG - Intronic
1181520048 22:23441771-23441793 TTATCTGTTTTCAAAGGTATTGG + Intergenic
949586465 3:5443939-5443961 ATTGCTCTTTGCTAGTGTATAGG + Intergenic
950639343 3:14338572-14338594 ATTTGTGGTTGCCAGGGCATGGG + Intergenic
951373117 3:21877193-21877215 CTTTCTGTTTGCATAGGAATGGG + Intronic
952464552 3:33568078-33568100 ATTTCATCTTCCAAGGGTATAGG + Intronic
955881121 3:63547127-63547149 ATTTCTGTTTGCTTTGATATTGG + Intronic
956069629 3:65434097-65434119 ACTTCTGTTTGAAAGGTTTTTGG - Intronic
956449721 3:69362080-69362102 CTTTTTGTTTGCACAGGTATAGG + Intronic
957648441 3:82966845-82966867 AATTCATTTTGCAAGGTTATTGG + Intergenic
958714496 3:97763780-97763802 TTTTTTGTTTGCATGGGTGTAGG - Intergenic
959901162 3:111663141-111663163 TTTTTTGTTTGAAAGGGTGTAGG - Intronic
960127229 3:114013611-114013633 ATTTCAGATTGCAAGGAAATTGG - Intronic
963996769 3:151718550-151718572 TTTTCTGTTTGTGAGGGTTTAGG + Intergenic
965755339 3:172020905-172020927 AGGTCTGTTTACAAAGGTATGGG + Intergenic
965859663 3:173133349-173133371 GTTTCTGTTTGTAGGGGTCTAGG + Intronic
966581034 3:181563749-181563771 ATTTCTGTTTGGAAAAGTAATGG + Intergenic
967149995 3:186639725-186639747 CTTTCTTTTAGCAAGAGTATGGG + Intronic
970017007 4:11522737-11522759 AACTTTGTTTACAAGGGTATGGG + Intergenic
971168344 4:24207337-24207359 TTTTGTGTTTGTATGGGTATTGG - Intergenic
972027426 4:34400847-34400869 ATTTATTTTTGAAAGGGTTTTGG + Intergenic
972143916 4:35997579-35997601 CTTTGTGTTTCTAAGGGTATAGG + Intronic
972195854 4:36653321-36653343 ATGGCTGTTTTCTAGGGTATGGG - Intergenic
972605205 4:40607327-40607349 ATTACTGGTTGCCAGGGGATGGG + Intronic
972999780 4:44932094-44932116 AATTGTTTTTGCCAGGGTATAGG + Intergenic
974239281 4:59224935-59224957 ATTTCTGTTAGGCAGGGCATTGG - Intergenic
974372159 4:61031473-61031495 ATTACTGTTTGCCAGGGACTAGG - Intergenic
974749759 4:66122406-66122428 ATTTTTGTTTTCAAGAGAATTGG - Intergenic
975182556 4:71363513-71363535 ATGTCTGAATTCAAGGGTATGGG - Intronic
976679403 4:87738615-87738637 TTTCCTGTTTGCAAGGATGTAGG + Intergenic
977447367 4:97148001-97148023 ATTTCTGTTTGGATGGGGAGGGG - Intergenic
978454564 4:108874089-108874111 ATTTCTGTTAACCAGGGTAGAGG + Intronic
978703090 4:111672946-111672968 ATTCCTGTTTTCAGGGGTTTAGG + Intergenic
980530369 4:134045362-134045384 ATTTCGGTTTGGAAGTGCATAGG + Intergenic
980689405 4:136274986-136275008 ATTACTGTTGCCAAGGATATTGG - Intergenic
981931244 4:150191338-150191360 ATTTCTGTTTGCAAGGGTATCGG - Intronic
982350878 4:154413859-154413881 AGTTCTGTTTACAAGGGTAAGGG - Intronic
983980212 4:173986626-173986648 ATGTCTATTTGTTAGGGTATAGG + Intergenic
984105925 4:175545630-175545652 AGTTGGGTTTGCAAGGTTATTGG - Intergenic
986300536 5:6475455-6475477 CTTTATGTTTGCAAGGAAATAGG - Intronic
987751743 5:22048035-22048057 ACTTTTGTTTGCAGGGGTAGGGG + Intronic
988583630 5:32490293-32490315 CTTTCTGTTTACAAAGGGATGGG - Intergenic
989046272 5:37276916-37276938 ATTTTTTTTTGGAAGGGTAGGGG + Intergenic
990189345 5:53241217-53241239 ATTTTTGTTTGCTAGTGTTTTGG + Intergenic
991994539 5:72374361-72374383 ATTACTGTATGTAAGGTTATTGG + Intergenic
992241339 5:74772856-74772878 ATTTTTGTGTGCATGGGGATGGG - Intronic
992628429 5:78656539-78656561 AATTCTGTTTGCAAGAGTATGGG - Intronic
994465907 5:100130721-100130743 ATTTTTGTATGCAAAGTTATTGG - Intergenic
994622822 5:102183259-102183281 ATTTTTCTTTGTAAGGGTACAGG - Intergenic
994906904 5:105852366-105852388 ATTTCTGTTCTTAAGGGTTTTGG - Intergenic
995156224 5:108916448-108916470 ATTTCTGTTTGGCAGGGGGTCGG - Intronic
998915382 5:147006005-147006027 ATTTTTGTTAGGAAGGCTATGGG - Intronic
999399740 5:151255375-151255397 ATTTCTGGTAGCAAAGGGATAGG + Intronic
1001972823 5:175970145-175970167 ATTTCTGGTTGCAATGGGGTAGG - Intronic
1002244615 5:177873637-177873659 ATTTCTGGTTGCAATGGGGTAGG + Intergenic
1002909133 6:1475398-1475420 ATTAGTGTTTGCCAGGGGATGGG + Intergenic
1004179301 6:13366947-13366969 ATTTCTGTTTAAAATGTTATAGG - Intronic
1004287707 6:14338048-14338070 ATCTCTGTTTTCAAAGGAATGGG - Intergenic
1006751963 6:36383998-36384020 AATGCTGTTTCCAGGGGTATTGG - Intronic
1008402344 6:51078320-51078342 ACTGCTGTTTGCATGGGAATGGG - Intergenic
1008872260 6:56286366-56286388 ATTTGTGTATACATGGGTATTGG - Intronic
1009376076 6:62971366-62971388 ATTTGTTTTTGCAATGTTATGGG + Intergenic
1010735657 6:79441388-79441410 ACTTCTGTTTGCAGGGCTCTGGG + Intergenic
1011116049 6:83893500-83893522 ATTTCTGTTTGCTTTGGTACAGG + Exonic
1011722360 6:90170990-90171012 ATTTCATCTTTCAAGGGTATTGG - Intronic
1012059040 6:94453877-94453899 ATTTGTATTTGCCAGGGTTTAGG + Intergenic
1014685027 6:124486650-124486672 GTTTCTGTTTGAAAGGATTTGGG + Intronic
1015633319 6:135252535-135252557 AATTCTGTTTGCGACGGTTTGGG - Intergenic
1016127141 6:140417938-140417960 GTTTATGTTTGCAAGAATATTGG - Intergenic
1017661778 6:156681881-156681903 AATTCTGGTTGCCAGGGGATGGG + Intergenic
1018163928 6:161076076-161076098 TTTTATTTTTGGAAGGGTATGGG - Intronic
1018409409 6:163527431-163527453 AATTCTGTTTGGAGGGGTTTTGG + Intronic
1019228238 6:170533229-170533251 ATTACTGCCTGCAAGGGGATTGG - Intergenic
1019591205 7:1834507-1834529 TTATCTGTTTTCAAAGGTATTGG - Intronic
1020912111 7:14143736-14143758 ATTTCTGTTTAAAATAGTATTGG - Intergenic
1021031815 7:15746520-15746542 ATTTCTGTGGACAAGGGGATGGG - Intergenic
1021090979 7:16482176-16482198 ATTTCTGTTTGCAAAGTGAAGGG - Intronic
1022590824 7:31661008-31661030 GTTCCTGGTTGCAAGGGAATCGG + Intergenic
1023538221 7:41236704-41236726 ATTTCTGAGTTCAAGGGTTTGGG + Intergenic
1023701647 7:42897715-42897737 AATTCTGTTTGAAAGGATAGTGG - Intergenic
1024172709 7:46806917-46806939 ATTTCTTTTTGAATGGGTATTGG + Intergenic
1029824938 7:103181241-103181263 ATTTGTGGTTGCAAGGGGTTAGG - Intergenic
1030417204 7:109260650-109260672 GGTTCTGTTTTCTAGGGTATGGG - Intergenic
1030443384 7:109618130-109618152 GTTTGTGTTTGCCAGGGTTTTGG + Intergenic
1033903837 7:146176552-146176574 ATTTCTGATTCCCAGGGAATTGG - Intronic
1036922282 8:12868998-12869020 ATGTCTGTTTCCAAGGGCAGTGG - Intergenic
1038717777 8:30007384-30007406 GTTTTTGTTTGCAAGGGTGGAGG - Intergenic
1039122249 8:34160337-34160359 ATTGCTGTTGGCAAGGGTTGAGG + Intergenic
1039532675 8:38277588-38277610 ATTTTTAATTGCAAGGGTAGTGG + Intronic
1039945692 8:42127436-42127458 ATTTATGGTTGCTAGGGGATAGG - Intergenic
1040620678 8:49088963-49088985 ATTTGTGTTTGCCAGGGTCTGGG - Intergenic
1041534661 8:58912580-58912602 ATTTCTGATTGAAAAGGTCTGGG + Intronic
1042065298 8:64868265-64868287 CTTTCTGTGTTCAAGTGTATGGG + Intergenic
1043833741 8:85020867-85020889 ATTTCTGTTTTCAGGATTATAGG + Intergenic
1043956130 8:86361570-86361592 AGTTCTGTTAGGAAGGGTATGGG - Intronic
1045431688 8:102120978-102121000 ATGTCTGTCTGCTAGGGAATGGG - Intronic
1045603385 8:103745192-103745214 ATTAGTGATTGCAGGGGTATAGG - Intronic
1045816256 8:106280552-106280574 AATGGTGTTTGCAAGGGGATGGG + Intronic
1047995092 8:130327095-130327117 ATTTCAATTTGCAAAGGTGTTGG + Intronic
1050226635 9:3465139-3465161 AGTTCAGATTGCAAGGGTTTGGG - Intronic
1052639173 9:31142553-31142575 GTTTCAGTTTGCAAGGGTATAGG - Intergenic
1052658851 9:31402143-31402165 ATTTTTGTTTGAAAGGGTGAGGG - Intergenic
1053106419 9:35412780-35412802 ATTAGTGGTTGCCAGGGTATAGG - Intergenic
1053123492 9:35562321-35562343 ATGTTTGTTTGTATGGGTATGGG - Intronic
1053659966 9:40265597-40265619 ATTCATGTTTGCAAGGGGCTGGG + Exonic
1053910339 9:42894937-42894959 ATTAATGTTTGCAAGGGGCTGGG + Intergenic
1054372097 9:64411890-64411912 ATTCATGTTTGCAAGGGGCTGGG + Exonic
1054524632 9:66110620-66110642 ATTCATGTTTGCAAGGGGCTGGG - Exonic
1054679716 9:67901599-67901621 ATTCATGTTTGCAAGGGGCTGGG + Exonic
1055785818 9:79867653-79867675 CTTTCTGTATGCCAGGGAATAGG + Intergenic
1056281818 9:85048895-85048917 ATTTCTATTTTCAAGGCTGTTGG - Intergenic
1057017202 9:91663072-91663094 ATTTCAGTCTGCCAGGGTCTGGG + Intronic
1060781732 9:126418109-126418131 GTTGCTGTTTGCAAGGGTGCTGG - Intronic
1060928889 9:127475623-127475645 ATTTCTGTTGGCCAGAGTATGGG + Intronic
1185578349 X:1191509-1191531 TTTTTGGTTTACAAGGGTATTGG - Intronic
1187984826 X:24798738-24798760 ATTTTTGAATGCAAGGGGATTGG + Intronic
1188298552 X:28480356-28480378 ATTAGTGTTTGCCAGGGAATGGG - Intergenic
1189047427 X:37608352-37608374 GTTTCTGTTTCCATGGGTCTGGG + Intronic
1192309736 X:70000589-70000611 ATTTCTGTTTGCTTGAGTTTGGG + Intronic
1192592627 X:72373386-72373408 ATTACTGGTTGCCAGGGGATAGG - Intronic
1192961546 X:76136555-76136577 AATACTGTTAGCAAGGCTATGGG - Intergenic
1194593156 X:95825971-95825993 GTTTGTGTTTGCCAGGGTTTAGG + Intergenic
1197283656 X:124567992-124568014 ATTTCTGTTTGAAAAGTAATAGG + Intronic
1199413792 X:147556566-147556588 ATTTTTATTTCCAAGGGTGTTGG - Intergenic
1201619025 Y:15934460-15934482 ATTTCTGTATCCAAGGCTCTAGG + Intergenic