ID: 981931245

View in Genome Browser
Species Human (GRCh38)
Location 4:150191344-150191366
Sequence TCTGTCATTTCTGTTTGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 343}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981931245_981931251 1 Left 981931245 4:150191344-150191366 CCCTTGCAAACAGAAATGACAGA 0: 1
1: 0
2: 2
3: 30
4: 343
Right 981931251 4:150191368-150191390 TCCAGGGAGTGGTGGAAGATAGG 0: 1
1: 0
2: 3
3: 25
4: 338
981931245_981931254 21 Left 981931245 4:150191344-150191366 CCCTTGCAAACAGAAATGACAGA 0: 1
1: 0
2: 2
3: 30
4: 343
Right 981931254 4:150191388-150191410 AGGTTAGCAAACCTGTTCCAGGG No data
981931245_981931250 -7 Left 981931245 4:150191344-150191366 CCCTTGCAAACAGAAATGACAGA 0: 1
1: 0
2: 2
3: 30
4: 343
Right 981931250 4:150191360-150191382 TGACAGATTCCAGGGAGTGGTGG No data
981931245_981931249 -10 Left 981931245 4:150191344-150191366 CCCTTGCAAACAGAAATGACAGA 0: 1
1: 0
2: 2
3: 30
4: 343
Right 981931249 4:150191357-150191379 AAATGACAGATTCCAGGGAGTGG 0: 1
1: 0
2: 1
3: 55
4: 431
981931245_981931253 20 Left 981931245 4:150191344-150191366 CCCTTGCAAACAGAAATGACAGA 0: 1
1: 0
2: 2
3: 30
4: 343
Right 981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG 0: 1
1: 0
2: 0
3: 1
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981931245 Original CRISPR TCTGTCATTTCTGTTTGCAA GGG (reversed) Intronic
901282171 1:8046453-8046475 TCTGTCATCTATTTTTGTAAAGG - Intergenic
904830553 1:33303805-33303827 CCAGTCATTTCTGTTTTAAAGGG - Intergenic
905092791 1:35442770-35442792 TGTGTATTTTCTGTTTGCAGAGG - Intronic
905678975 1:39853044-39853066 TCTGTCTTTTTTGTTTGCTGTGG - Intronic
906673555 1:47677334-47677356 TTTGTCATTTCTGATGGAAACGG + Intergenic
907370723 1:54001653-54001675 TCTGCCATCACTGTTTGCAGGGG - Intergenic
908501392 1:64745949-64745971 TCTGTCTTCTCAGTTTGCTAAGG + Intronic
909037320 1:70608842-70608864 TCTGTCTTTTCTCCTTTCAAAGG + Intergenic
909258770 1:73459641-73459663 TGTGCCATTTCTGTTTTCATTGG - Intergenic
909555209 1:76946002-76946024 TCAATCATTTCTGTATGCTAAGG - Intronic
910435611 1:87202473-87202495 ACTGTAAATTCTGTTTCCAAAGG - Intergenic
910999750 1:93150641-93150663 ACTGTCTTTTCTTTCTGCAATGG + Exonic
911247329 1:95532900-95532922 TCTGTGGGTTCTGTTTGCATGGG + Intergenic
911895330 1:103426419-103426441 TTTGGCATTTCAGTTTGCTATGG - Intergenic
913105655 1:115611947-115611969 TCTTTCATTTCAGTTAGCCATGG + Intergenic
913678100 1:121161385-121161407 TCAGTCATTTCTGCTTCCTATGG + Intergenic
914029936 1:143949014-143949036 TCAGTCATTTCTGCTTCCTATGG + Intronic
914159513 1:145118936-145118958 TCAGTCATTTCTGCTTCCTATGG - Intergenic
914684556 1:149966973-149966995 TTGGTCATTTCTGTTCACAAGGG + Intronic
914999734 1:152578478-152578500 TCTTTCTTTTCTTTTTGAAATGG + Intronic
916535591 1:165700151-165700173 TGTTTCAATTCTGTTTGCAATGG - Intergenic
917069744 1:171137383-171137405 TCTTTCATTTATGTTTGCTTTGG - Intergenic
919188521 1:194185504-194185526 TCTATTATTTCTGTTTGCTTAGG + Intergenic
919606269 1:199688377-199688399 TCTGACATTCCTTCTTGCAAAGG - Intergenic
919962476 1:202485535-202485557 TCTGGCATTTGTGGTAGCAATGG + Intronic
921220407 1:212969693-212969715 TCTGTCTTTTCTCTTTGCTTTGG + Intronic
921234277 1:213109139-213109161 TCTGTAATTTCTTTTTGAGACGG + Intronic
921398133 1:214690596-214690618 TCTTTCCTTTCTTTTTTCAAAGG - Intergenic
921691940 1:218162207-218162229 TCCTTCATTTCTTTTTGAAATGG - Intergenic
921913821 1:220583329-220583351 TCTATCATTGATGTTTGCAAAGG - Intronic
922576654 1:226665394-226665416 ATTTTCATTTCTGTTTGCAGAGG - Intronic
923771480 1:236941694-236941716 TCATACATTTCTGTTTGCCAGGG - Intergenic
924266214 1:242284868-242284890 TCTATCCTTCATGTTTGCAAAGG + Intronic
1063778346 10:9290922-9290944 TCAGTCATTTCTGTTGACAAAGG - Intergenic
1064506420 10:16035217-16035239 TCTTTCTTTTCTCTTTCCAAAGG - Intergenic
1065674489 10:28159501-28159523 TCTTTCATTTCTGGCTACAAAGG + Intronic
1066718616 10:38313692-38313714 TCTATCCTTCATGTTTGCAAAGG - Intergenic
1068024165 10:51622187-51622209 TGTGTCATATCAGTTTGAAAAGG + Intronic
1068207693 10:53877678-53877700 TCTGTTTTTTCTTTTTGCATAGG + Intronic
1069188419 10:65457735-65457757 TTTGTACTTTCTGTTTGCAAAGG - Intergenic
1070692756 10:78539675-78539697 CCTGGCATTCCTGTTTGCTATGG + Intergenic
1076445027 10:130508613-130508635 TCTTTGTTTTCTGTGTGCAAGGG + Intergenic
1076530664 10:131142295-131142317 TCTGGCATTTGTGTTTTCAGCGG + Intronic
1076573873 10:131451233-131451255 GCTGTCATTTATTTTTGAAATGG - Intergenic
1078745363 11:14108811-14108833 TCTGTGATTTCTGTTGGCCAAGG + Intronic
1078962721 11:16297621-16297643 TCTGTCATTTCTGTTTGAATGGG - Intronic
1079196774 11:18335324-18335346 CATGGCATTTCTTTTTGCAAGGG - Intronic
1080233595 11:30044953-30044975 TCCCTCCTTTCTGTCTGCAAAGG - Intergenic
1080569777 11:33545258-33545280 TCTGTGTTTTCTGCTCGCAATGG - Exonic
1084703825 11:70804483-70804505 TCTGTCATTTCTGTTCTCCCTGG + Intronic
1085713285 11:78849846-78849868 TCACTCATTGCAGTTTGCAAAGG - Intronic
1085858159 11:80199247-80199269 TCTGTCATCTGTGTGTTCAATGG - Intergenic
1086234228 11:84608587-84608609 TCTGTGAGATCTGTTTTCAAGGG - Intronic
1086438288 11:86802621-86802643 TCTGTCATTACTGTTTATAGCGG + Intronic
1086916148 11:92532074-92532096 TCAGTCATTTCATTTTGCACAGG - Intronic
1087371214 11:97287294-97287316 TCTGTCCTTTCTATATACAATGG + Intergenic
1087373022 11:97308552-97308574 TCCATCATTTCTGATTGGAATGG - Intergenic
1087719760 11:101649245-101649267 TGTGTCACTCCTGATTGCAATGG - Intronic
1088091116 11:106041169-106041191 TATGTCTTTACTGTTTGCTATGG + Intergenic
1088181216 11:107114229-107114251 TCTGTGATTTCTTTGAGCAATGG - Intergenic
1088540722 11:110911113-110911135 CCTGTCTTTACTGTTTGCCATGG - Intergenic
1092050199 12:5463938-5463960 TTTGTCATTCCTCTTTGAAATGG + Intronic
1093144445 12:15547847-15547869 GCTCTCATTTCTTTATGCAAGGG + Intronic
1093242222 12:16691244-16691266 TATGTCATTTTTCTATGCAATGG + Intergenic
1093307418 12:17538020-17538042 TCTTTGATTTCTGTATTCAAGGG + Intergenic
1093477204 12:19569235-19569257 TGTCTCATTTCAGTTTTCAATGG + Intronic
1094319290 12:29168246-29168268 TCAGTAATTTCTGTCAGCAAAGG - Intronic
1094405847 12:30115442-30115464 TCTGTCCTTTCTGCTTGTAATGG - Intergenic
1095759227 12:45809533-45809555 ACTGTAAATTCTGTCTGCAAGGG + Intronic
1097063204 12:56300960-56300982 GCTGTCAGTTCTGTGTGTAATGG + Intronic
1098928648 12:76382980-76383002 GCTGACATTTCTGTTTTGAATGG + Intronic
1101292323 12:103383686-103383708 TATGTCATTTATGTTGGCTATGG - Intronic
1101798945 12:108003729-108003751 TCTGTGCTGTCTGTTGGCAATGG - Intergenic
1102436047 12:112924651-112924673 TCTTTAATTTCATTTTGCAATGG + Intronic
1104337889 12:127917848-127917870 CCTTTGATTTCTCTTTGCAAAGG - Intergenic
1106035670 13:26042665-26042687 TCTGTCATTTCTGCTGCCACTGG - Intergenic
1106490358 13:30216002-30216024 TCTGTCATATTCGTTTGCTAGGG - Intronic
1106842458 13:33698865-33698887 AATGTGATTTCTATTTGCAAGGG + Intergenic
1107733481 13:43371600-43371622 ACCTTCATTTCTGTTTACAAAGG + Intronic
1107749360 13:43547881-43547903 TCTGTCTTTCCTGATTGCACTGG - Intronic
1108119584 13:47170221-47170243 TTTATCATTTCTTTTGGCAATGG + Intergenic
1108857623 13:54814347-54814369 TCTGTCTTTTAAGTTTTCAAAGG - Intergenic
1109232393 13:59774561-59774583 TCTGACATTTGTCTGTGCAAGGG + Intronic
1109340227 13:61047804-61047826 TCTGTCATTACTGGCTGCCACGG - Intergenic
1109526677 13:63584258-63584280 TGTGTAATTTCTGTTGTCAAAGG + Intergenic
1109554378 13:63952448-63952470 AATATCATTTCTGATTGCAATGG - Intergenic
1109947838 13:69461967-69461989 TTTGTAATGTCTGTTTGAAAAGG - Intergenic
1110153552 13:72285085-72285107 TCTGTCATTTCTTCTTTCATAGG - Intergenic
1111204494 13:84987333-84987355 TTTTTCATTTCTGTTTTTAAGGG - Intergenic
1111479071 13:88798372-88798394 CATGTCATTTCTTTTTGCAAAGG + Intergenic
1111755128 13:92383156-92383178 TCTGTCATTTCATTTCCCAAAGG + Intronic
1114994328 14:28328895-28328917 TTTTGTATTTCTGTTTGCAATGG + Intergenic
1115034615 14:28841931-28841953 TATGTTTTTCCTGTTTGCAAAGG + Intergenic
1115502062 14:34059255-34059277 TGTGTCATTTCTGTGGGCCACGG + Intronic
1119469804 14:74888737-74888759 TAAGTCATTTCGGTCTGCAAAGG + Intronic
1120356719 14:83443624-83443646 TCAGCCATTGCTGTTTGCCAGGG - Intergenic
1120913717 14:89691149-89691171 TCTGACATATATTTTTGCAAAGG + Intergenic
1121133580 14:91473119-91473141 TCAGTCTTTTCTGTTTTCTAAGG + Exonic
1121963046 14:98278807-98278829 TCTGTGATTTTTCTTTCCAAGGG - Intergenic
1123189293 14:106552726-106552748 TCTGTCATTTATTAATGCAATGG + Intergenic
1124604723 15:31161637-31161659 TGTGTCATTTCTGATTTCAGGGG + Intergenic
1125287862 15:38113218-38113240 TCTTTCTTCTCTGTTTGCCAGGG + Intergenic
1125781366 15:42272121-42272143 TCTTTCCTTTATGTTTGCAGGGG - Exonic
1126344869 15:47682481-47682503 TGTGTCAGTTATCTTTGCAATGG + Intronic
1130552117 15:84896027-84896049 TTTGTGATTTATTTTTGCAATGG + Intronic
1131927916 15:97406429-97406451 TCTGCCTTTTCATTTTGCAATGG - Intergenic
1132214415 15:100052102-100052124 TGTGTCTTTCCTGTCTGCAAGGG - Intronic
1134180772 16:12045971-12045993 TCTGTAATTTCTGTCTGAAATGG + Intronic
1134397483 16:13878431-13878453 TCTGTCCTTGCTCTTTGGAATGG + Intergenic
1135169633 16:20172353-20172375 TCTGTCATTTGTACCTGCAATGG - Intergenic
1135243251 16:20829836-20829858 TCTGTCTTTTCTGTATACCAGGG + Intronic
1135307520 16:21379734-21379756 TCTGTAATTTCTGTCTGAAATGG + Intergenic
1136304265 16:29358854-29358876 TCTGTAATTTCTGTCTGAAATGG + Intergenic
1137757121 16:50911601-50911623 TTTGTCATAACTGTTTGTAATGG - Intergenic
1141220667 16:82066507-82066529 TCTGTAATTTCTTTTTTTAAAGG - Intronic
1141457123 16:84150573-84150595 TCTTTCATTTTTGTTTCCTAAGG + Intronic
1143729154 17:8870625-8870647 TTTGTCATTTCAGTTTTCTAAGG + Intergenic
1143841350 17:9734573-9734595 GCTGTCATTTCTTTTGGGAATGG + Intergenic
1145830943 17:27915673-27915695 TATGTCATTTCTGTTCGCTCTGG + Intergenic
1146629105 17:34457519-34457541 TGTGACATGCCTGTTTGCAATGG - Intergenic
1147351972 17:39855512-39855534 TAGGTCATTGATGTTTGCAATGG + Intronic
1150866992 17:68861761-68861783 TTTGTCATTTTTGGTTGCTATGG + Intergenic
1151057347 17:71048950-71048972 CCTGTTATTTCAGTTTGCAACGG - Intergenic
1153012380 18:550609-550631 TCTGTCTTTTCTATTTGGATTGG + Intergenic
1153096978 18:1418259-1418281 TCTTTCATTTTTTTTTGTAAAGG + Intergenic
1153328152 18:3843000-3843022 TCTGTCAGGCCTTTTTGCAATGG + Intronic
1155535908 18:26817161-26817183 TCTTTCATTTATTTTTGCTATGG + Intergenic
1156481032 18:37436555-37436577 TCTGTTATTCCTGTTTGCTTAGG + Intronic
1160035596 18:75299061-75299083 GCAGTCATTTCTGTATGCACTGG + Intergenic
1160522483 18:79515825-79515847 TCTGTTAATTCTGTTTGAAATGG + Intronic
1162840190 19:13350549-13350571 TATGTGATTTCTGTTGGTAATGG - Intronic
1163147786 19:15393094-15393116 TCTTTCATTTCTTTTTCAAATGG + Intronic
1163663504 19:18592343-18592365 TCTGCCATCTCTGTGTACAAGGG + Intronic
1165722632 19:38090569-38090591 TCTGTCATTTCTGCTTCCCTGGG - Intronic
925121155 2:1419527-1419549 TCTGTCCTTTCTGTTGGAGAGGG - Intronic
925583705 2:5441091-5441113 CCTGTTGATTCTGTTTGCAAAGG - Intergenic
925786545 2:7436644-7436666 ACTCTCAGTTCTATTTGCAATGG + Intergenic
927047031 2:19289695-19289717 TATGTGTTTGCTGTTTGCAAAGG - Intergenic
927767644 2:25827323-25827345 TCTGTGTTTTCTGTTTGTAAAGG - Intronic
929283881 2:40114266-40114288 TCTGTCAGTTTTATTTTCAAAGG - Intronic
929465140 2:42137410-42137432 TTTGTCTTTTGTGTTTTCAATGG + Intergenic
929980634 2:46676091-46676113 TCTTTCATTTCATTTTGAAACGG - Intergenic
930618140 2:53615284-53615306 GCAGTCATTTCTATCTGCAATGG - Intronic
931076498 2:58720266-58720288 TCTGTCATCAGTGTTTGCATAGG + Intergenic
931382967 2:61770549-61770571 CCTGTGATTTCTGTCTGCATGGG - Intergenic
932209731 2:69916717-69916739 TTTGTCATCTCTATTTGTAATGG + Intronic
932242139 2:70165830-70165852 TGTGTTTTTTATGTTTGCAAGGG - Intronic
934733033 2:96671380-96671402 TCTGGCCATTCTGTTTCCAAAGG - Intergenic
935023569 2:99255045-99255067 TCTCCCCTCTCTGTTTGCAAAGG + Exonic
935897310 2:107751440-107751462 TCTGTGACTTCTGTTTGAGATGG + Intergenic
936043118 2:109164923-109164945 ATTGTCATTTTTATTTGCAATGG - Intronic
936949705 2:117965671-117965693 TCTGTAATTTATGTTTTCACAGG + Intronic
937458096 2:122061394-122061416 TCTGTCACATCCATTTGCAATGG - Intergenic
937530684 2:122823619-122823641 GCTACCATTTCTGTTTTCAAAGG - Intergenic
938441384 2:131337312-131337334 TCTGTCATTACTGTTCTCCAAGG + Intronic
939486549 2:142819634-142819656 TCTGTCATTCCTGTGTTCACTGG + Intergenic
940115883 2:150207718-150207740 CCTGTCCTTTCTGTTAGAAATGG - Intergenic
940778033 2:157905031-157905053 TCTGTCATTTGTGTCTGTCAAGG + Intronic
941144025 2:161820493-161820515 TCTGGCCTTTCTTTTTACAATGG + Intronic
941511830 2:166420450-166420472 TCTCCCATTTCTGTATACAATGG + Intronic
942659713 2:178251448-178251470 TGTGCCATTTCTGCTTGCAAGGG + Intronic
943190704 2:184675803-184675825 CCTGTCATTTCTTTTTTCATTGG + Intronic
943244948 2:185434915-185434937 TCAGTCTTTTCTTTTTGAAAAGG + Intergenic
943482169 2:188433354-188433376 TCTGTCATTTGTTTATGCAACGG + Intronic
944324840 2:198392113-198392135 TCTGTCATTTCTTTTTCTGAAGG + Intronic
944335218 2:198525747-198525769 TCTGTGACTTTTGTTTTCAATGG + Intronic
944840172 2:203616996-203617018 TCTTTCTTTTCTTTTTGAAATGG + Intergenic
945603544 2:211897471-211897493 TTTGACTTTTCTATTTGCAAAGG - Intronic
945751002 2:213782516-213782538 TATGTAATTTCTTTTTGAAAGGG - Intronic
948097321 2:235346813-235346835 TCTATCCTTGCTGTGTGCAAGGG + Intergenic
948582989 2:239000513-239000535 TCTGCAATTTCTATTTGCTATGG - Intergenic
1169275408 20:4230494-4230516 TCTGTCATTTCATTTTGCTTAGG + Intronic
1169399163 20:5265159-5265181 TCTCTTATTTGTGTTTGTAACGG + Intergenic
1170565434 20:17599550-17599572 TCTGTCATTTGTTTTTCCATTGG - Intronic
1170688839 20:18593834-18593856 TCTGTCATTGCTGTTTGAGTGGG + Intronic
1171137966 20:22714531-22714553 TCTCTGATTTCTGTGAGCAATGG + Intergenic
1171366338 20:24627273-24627295 TTTGTCATTTGTATTTTCAAGGG - Intronic
1172300426 20:33845875-33845897 TCTGACATTACTGATGGCAAAGG + Intronic
1172384074 20:34521021-34521043 TCTGTCTTTTTTTTTTGAAATGG + Intronic
1173131344 20:40396971-40396993 TCTCTCTCTTCTGTTTGCCATGG + Intergenic
1174209228 20:48864097-48864119 TGTGTCATTGCTTTTTCCAATGG - Intergenic
1174433910 20:50491671-50491693 TCATTCTTTTCTGTGTGCAAGGG + Intergenic
1175209237 20:57339211-57339233 TCTGTCATCTGTGTTTGCACTGG - Intronic
1176025844 20:62985208-62985230 TCTGCTTTTTTTGTTTGCAAAGG - Intergenic
1177009244 21:15711826-15711848 TTTGCCATTTCAGTTTGAAAAGG - Intergenic
1179101690 21:38360042-38360064 TCTGTCATGGCTGTGTGCCACGG - Intergenic
1179238876 21:39571092-39571114 TTTGTCATTCCTGATTGAAATGG + Intronic
1180858827 22:19065057-19065079 TCTGTCCTTTATGTTTCCTAGGG - Exonic
1181505276 22:23351888-23351910 TCTGTCTATTCTGATTGCATAGG + Intergenic
1182887903 22:33791447-33791469 TCAGTCTTTTCTGTTTGCAAAGG + Intronic
1183019028 22:35012550-35012572 TCTCTCCTTTCTGTGTGGAAGGG - Intergenic
1183833300 22:40431291-40431313 TCTCCCATTTCTGTTGGCAGTGG - Intronic
951275508 3:20680554-20680576 TCTGTCATTTCTGGTTGATTGGG - Intergenic
951921291 3:27857257-27857279 TCTGTGATTTCTTTGAGCAATGG - Intergenic
953915423 3:46917019-46917041 TCTTTCATTCCTGTTTACACTGG + Intergenic
954580346 3:51699856-51699878 TCTGTGATCTTTGTTTCCAAGGG - Intronic
955434626 3:58889453-58889475 CCTCTCAGTTCTGTTTGCATGGG - Intronic
955728315 3:61956768-61956790 TATGACATTTCTGATTGGAAAGG + Intronic
956985257 3:74691241-74691263 TTTGTGATTTCTATTAGCAATGG - Intergenic
958499993 3:94893186-94893208 GCTGTGATATTTGTTTGCAATGG + Intergenic
959144475 3:102528199-102528221 TCTGTTATTTCTGTATCAAATGG - Intergenic
959481168 3:106874090-106874112 CCTTGCATTTCTGTTTGCAATGG + Intergenic
960162310 3:114363929-114363951 GCTGAAATTTCTTTTTGCAAGGG - Intronic
962453168 3:135538880-135538902 AATGTAATTTCTGTTTGCAACGG - Intergenic
964090678 3:152872903-152872925 TCAGTTATTTCTTTTTGCACAGG - Intergenic
966282552 3:178249500-178249522 CCTGTCATTTATGTGTGCACTGG + Intergenic
966402176 3:179559213-179559235 TCTGTTATTTCAGTTCTCAAAGG - Intergenic
970009383 4:11442507-11442529 TCTGTCATTTTTGGTTTCAAAGG - Intergenic
970335792 4:15040489-15040511 TAATTCATTTCTGTTTGCTATGG + Intronic
970523601 4:16909789-16909811 ACTGTCGCTCCTGTTTGCAAGGG + Intergenic
970785120 4:19786358-19786380 TGTTTCATTTATGTTGGCAATGG - Intergenic
971518211 4:27515225-27515247 TTTGTCATTTCTCTGTGTAATGG + Intergenic
972969630 4:44557263-44557285 CCTGCCATTTCTCTTTGCCATGG - Intergenic
973879722 4:55257245-55257267 TATTTAATTTCTCTTTGCAATGG - Intergenic
973890029 4:55359529-55359551 TCTGTTGTTCCTGTCTGCAAGGG + Intronic
974570085 4:63634457-63634479 TCAATCTATTCTGTTTGCAATGG + Intergenic
974765804 4:66344243-66344265 TCTGTTATTTCCATTTGAAATGG - Intergenic
974988955 4:69061687-69061709 GGTGTCATTTCTATGTGCAATGG + Intronic
975250599 4:72174110-72174132 AATGTCCTTTCTTTTTGCAATGG - Intergenic
975596907 4:76056049-76056071 TCTGTCCTTTCTGTTTCCTCTGG - Intronic
976456280 4:85250381-85250403 TCAGTCATTGCTGTAGGCAATGG + Intergenic
978229656 4:106384012-106384034 TCAGTTATTGATGTTTGCAATGG + Intergenic
978469639 4:109049836-109049858 TCTGTCCTTTCTATGTACAATGG - Intronic
980485766 4:133456054-133456076 TCTGTCATTCCTGTTAGTATCGG - Intergenic
981637368 4:146896369-146896391 TCTGGCATTTATTGTTGCAAAGG + Intronic
981931245 4:150191344-150191366 TCTGTCATTTCTGTTTGCAAGGG - Intronic
981950439 4:150400024-150400046 TCTGGCATTTTTGTAGGCAAAGG + Intronic
982714607 4:158793689-158793711 CCTCTCAGTTCTGTTTGCATGGG + Intronic
982895901 4:160925094-160925116 ACTGTTATTTCTGTTTGCACAGG + Intergenic
982953633 4:161734275-161734297 TATTTTATTTCTGTTTGTAAAGG - Intronic
983094523 4:163545741-163545763 TCCTTCATTTCTGATTGCAGTGG - Exonic
986274556 5:6262264-6262286 TATTGCATTACTGTTTGCAATGG + Intergenic
986348461 5:6855736-6855758 TCTCTCATGTCTTTTTGTAAGGG + Intergenic
986928062 5:12783059-12783081 TCTGTCTTCTCTGTTAGGAATGG - Intergenic
987001828 5:13667637-13667659 TGGGTCATTTTTGTTTGGAAAGG + Intergenic
987259699 5:16190655-16190677 CCTGTTATTTCTGTCTGCCAGGG - Intergenic
987499439 5:18688701-18688723 TCAGTTATTTTTGTTTGTAAGGG + Intergenic
987511184 5:18841700-18841722 TCTGCCATTTCTGTTTTCCGTGG + Intergenic
988191370 5:27940145-27940167 TCTGTCATTTATGGTAGCAGTGG - Intergenic
988583633 5:32490299-32490321 TCTTTTCTTTCTGTTTACAAAGG - Intergenic
988654471 5:33193122-33193144 TCTGTCCTTTCTCTTTTCCAGGG + Intergenic
989798676 5:45507579-45507601 ACTGTTATTTCTCTTTGAAAAGG - Intronic
990120738 5:52448066-52448088 GTTTTCATTCCTGTTTGCAATGG + Intergenic
990157527 5:52895964-52895986 TATGAAATTTCTGTTTGCCAAGG + Intronic
990223893 5:53627544-53627566 TCTTTTATTTCTTTTTGCAGTGG + Intronic
990409887 5:55531811-55531833 TCCTTCACTGCTGTTTGCAATGG + Intronic
990864031 5:60360467-60360489 TCTGCCATTGCTGTGTGAAAAGG - Intronic
991455744 5:66801654-66801676 CCTGTCTTTTCTTTTTGGAAAGG + Intronic
992939208 5:81746488-81746510 TTTGTCATTTTTCTTTGCAGGGG + Intronic
992998522 5:82356603-82356625 TCTGTCATTATTATTTTCAATGG - Intronic
993113581 5:83690141-83690163 TCTGTCATATCTGTTTGTGCTGG + Intronic
994901383 5:105775713-105775735 ACTGTTATTTCTCTTTGTAATGG + Intergenic
995096724 5:108244695-108244717 GTTGTCATTTCTGTTTCTAATGG - Intronic
995478434 5:112571151-112571173 TCTGTCATTTGTATCTGCAAGGG - Intergenic
995584972 5:113639378-113639400 TCTGTCAATTCTCTTTCCAAGGG + Intergenic
995809690 5:116090750-116090772 TCTGAGATTTCTGTTTGCTCTGG + Intronic
995923935 5:117346176-117346198 TATGTGATCTCTGTTTTCAATGG + Intergenic
996160962 5:120164225-120164247 TCTGTCATGTCTGTTATCTATGG - Intergenic
996251263 5:121335601-121335623 TTTGTAATTTCTGTTTCCAAAGG - Intergenic
996391854 5:122970867-122970889 TTTCTCATCTCTGTTTGCCAAGG + Intronic
996582084 5:125042390-125042412 TCTGGCTTTCCTGGTTGCAAAGG - Intergenic
997015118 5:129923675-129923697 TCTGCCAATTGTGTTTCCAAGGG - Intronic
997325736 5:133019409-133019431 TATTTCATTTCTATTTGCTAAGG + Intronic
998718579 5:144915176-144915198 TTTGTCATTTTTGTTTACAGTGG - Intergenic
999014272 5:148082196-148082218 TCTGTTGTTTCTGTTTTCTATGG + Intronic
999353248 5:150898183-150898205 TCTGTGATTTCTGTTTAATAGGG - Exonic
999443996 5:151624238-151624260 CCTGAGATTTCTGTTTGCAGGGG + Intergenic
999476269 5:151901666-151901688 TTGGTCATTTGAGTTTGCAAAGG + Intronic
999496261 5:152101342-152101364 TCTGTAAGTTCTGTTAGCAGAGG + Intergenic
1001257999 5:170199907-170199929 TGTTTCATTTCTGTCTACAAGGG + Intergenic
1001672194 5:173483091-173483113 TCTGTCTTTTCCATTTGGAAGGG + Intergenic
1003761983 6:9188790-9188812 TCTGTCTTTTCTGTGTGAAGAGG + Intergenic
1005064199 6:21802445-21802467 TCTGTAGTTTCCATTTGCAAAGG - Intergenic
1005286242 6:24330150-24330172 GCAGTCAGTTTTGTTTGCAAGGG + Intronic
1005932335 6:30492849-30492871 TCTGGCTTCTCTTTTTGCAAGGG + Exonic
1006042662 6:31269079-31269101 TCTGGCATCTCTTTCTGCAAAGG - Exonic
1006052252 6:31354201-31354223 TCTGGCATCTCTTTCTGCAAAGG - Exonic
1006882385 6:37351683-37351705 TTTTTTCTTTCTGTTTGCAAAGG + Intergenic
1006942771 6:37763787-37763809 CCTGGCATTAGTGTTTGCAAGGG + Intergenic
1008262476 6:49384057-49384079 TCTGTCATTTAAGATTGCAAAGG - Intergenic
1008553136 6:52652270-52652292 AATGTCAGTTCTGTTTGCAAAGG - Intergenic
1009602277 6:65817156-65817178 TCTTTCATTACTGTTTGGCATGG + Intergenic
1010399518 6:75432437-75432459 TCTGTGATTTATCTTTTCAATGG - Intronic
1010468442 6:76196846-76196868 TTTGTCTTTTTTTTTTGCAATGG + Intergenic
1010656237 6:78514713-78514735 TCTCTTCTTTCTGTTTGGAATGG + Intergenic
1011399907 6:86949063-86949085 TCTGTCATTTGTCTTTTAAAAGG + Intronic
1011899977 6:92281224-92281246 TCTCTCATTTCAGTTGGAAAAGG + Intergenic
1012141746 6:95634075-95634097 TATGTCATTTCCTTTTGAAATGG - Intergenic
1013280108 6:108628309-108628331 TTTGTCATTTTTCTTGGCAAAGG - Intronic
1014053287 6:116982000-116982022 TCTATTATTTCTGTTTTCAAAGG - Intergenic
1014599866 6:123398007-123398029 TCTTTTATTTCTTTTTGAAATGG + Intronic
1014831891 6:126112394-126112416 TCTGTCTTTTCTTTTTTGAAGGG + Intergenic
1014950406 6:127547736-127547758 TCTGGCACTTTTATTTGCAAGGG - Intronic
1014966318 6:127757388-127757410 TCTGCCATTTATGTATGCACGGG - Intronic
1015204250 6:130616989-130617011 TCTGACGTGTCTGTTTACAAGGG + Intergenic
1015941306 6:138455094-138455116 TTTCTCATTTTTGTCTGCAATGG + Intronic
1016340768 6:143060216-143060238 TCTCTCAATTCTGCTTTCAATGG - Intergenic
1016814331 6:148289801-148289823 GCTGTCATTTGTGTTCACAATGG - Intronic
1016880658 6:148908502-148908524 TCTGTCATTTGGGATAGCAATGG - Intronic
1018522778 6:164669761-164669783 TGTTTCATTTCTGTTTTTAATGG - Intergenic
1019815399 7:3196268-3196290 TATGTCATTTCTGTTTTAAGAGG + Intergenic
1020479922 7:8646857-8646879 TCTGTCATTTTTTTTTTTAAAGG + Intronic
1020700770 7:11479928-11479950 TTTATCATTTCTTTTAGCAAGGG - Intronic
1021048388 7:15952066-15952088 TATGTCAATGCTGTTTGCAAAGG + Intergenic
1021472201 7:21016702-21016724 TCTATCATTTGTGTTTTCACTGG + Intergenic
1022813382 7:33890709-33890731 TTTTTCATTTTTGTTTTCAATGG + Intergenic
1022880650 7:34583718-34583740 TCTAACATTTCTCTTTGCTATGG + Intergenic
1023070832 7:36431434-36431456 TCTGTCATTTCTATTGCCCAGGG - Intronic
1023611796 7:41979102-41979124 TCTGTCATTTTTCCTTGCCAAGG + Intronic
1024418177 7:49132667-49132689 TGTGTGATTTGTGTTTACAAGGG - Intergenic
1024529595 7:50380390-50380412 TCTGCCCTTTCTGTCTGCGATGG + Intronic
1027911333 7:84255181-84255203 ACTGATATTTCTGTTTGCTATGG - Intronic
1028589204 7:92478724-92478746 GCTGTCTTTTCTGTTAGAAAAGG - Intergenic
1030327679 7:108238469-108238491 TCTGTCGTTACTACTTGCAAAGG + Intronic
1031428548 7:121637338-121637360 TCTGTCATTTTTCATTTCAATGG - Intergenic
1031600419 7:123700950-123700972 TCGGTTATTTCTGTTGACAATGG + Intronic
1032458593 7:132092858-132092880 TCTGTTATTTCTGTTTGTGTAGG + Intergenic
1032949896 7:136895631-136895653 TCTCTCTTTTTTGGTTGCAATGG + Intronic
1033513127 7:142080591-142080613 TCTGTCATTTCTCATTACTAAGG - Intronic
1033732419 7:144192964-144192986 TTTGTCATGCCTGATTGCAACGG - Intronic
1033743267 7:144291544-144291566 TTTGTCATGCCTGATTGCAACGG - Intergenic
1033750631 7:144358051-144358073 TTTGTCATGCCTGATTGCAACGG + Intronic
1034437323 7:151069390-151069412 ACTGTTATTTCTGTGTGCAATGG + Intronic
1034759352 7:153656936-153656958 TCTGAAATTTCTGTTAGCTATGG + Intergenic
1036392154 8:8332885-8332907 TATGTTCTTACTGTTTGCAACGG + Intronic
1038257781 8:25966450-25966472 TATGCTATTGCTGTTTGCAAGGG - Intronic
1038529792 8:28309076-28309098 TCTGTTATTTGATTTTGCAAAGG + Intergenic
1039266154 8:35826290-35826312 TCTGTCATTTTTGTTGACATTGG - Intergenic
1039421642 8:37448380-37448402 ACTGTGATTTGTGTATGCAATGG + Intergenic
1040088653 8:43371907-43371929 TCTGTGATTTCTGTCTGCCTTGG + Intergenic
1040700347 8:50055977-50055999 TCTATCCTTTCTGTTTTGAAGGG + Intronic
1040825587 8:51617470-51617492 TTTGGCATTTCTGTTTGCAGTGG - Intronic
1041387398 8:57319014-57319036 GCTGCCATTTCTGTTAGAAAAGG + Intergenic
1044245091 8:89934559-89934581 TCTGTTGCTTCTGTTTACAAGGG + Exonic
1044979465 8:97701128-97701150 TGTGTCATATCTGTTTTCATAGG + Intronic
1046581702 8:116101126-116101148 TCTGTCAATTTTGTTTTCAAGGG - Intergenic
1047471645 8:125179565-125179587 ACAGTCAGTTCTCTTTGCAATGG + Intronic
1047920161 8:129627537-129627559 TCAGTCATCTCTGTTCCCAAAGG + Intergenic
1048248974 8:132842081-132842103 TCAGTTATTTATGTTTGCCATGG + Intronic
1048719820 8:137311024-137311046 TCTGAAATTTCTGTTCACAAAGG - Intergenic
1050073872 9:1843709-1843731 TCCCTCATGTCTGTTTGTAAGGG - Intergenic
1050199271 9:3126085-3126107 GCTGTCATCTCTGTTTGCCTGGG - Intergenic
1050271203 9:3947156-3947178 TCTGTCTTCCCTGTTGGCAATGG + Intronic
1051009249 9:12390528-12390550 TCTGGCATTTCTCTATGGAATGG + Intergenic
1051654001 9:19360875-19360897 TAGGTCATATCTGTCTGCAAGGG + Intronic
1051790915 9:20801302-20801324 TCTGTCATTCCTAATTTCAACGG - Intronic
1052109079 9:24557995-24558017 CTTGTAATTTCTGTTAGCAATGG + Intergenic
1053274933 9:36776151-36776173 TCTTTCATAACTGTTTGCAGAGG + Intergenic
1053460163 9:38262535-38262557 TCTGCCATTTCTGTATACCAAGG - Intergenic
1054194841 9:62020587-62020609 TCTTTAATTTCTTTTAGCAATGG + Intergenic
1054643567 9:67568103-67568125 TCTTTAATTTCTTTTAGCAATGG - Intergenic
1055043086 9:71896751-71896773 TCTGTCATTTGCCTTTGAAAAGG - Intronic
1055289251 9:74765807-74765829 TCTTTAATTTCTATTTACAAAGG - Intronic
1055538740 9:77278435-77278457 ACTCTTTTTTCTGTTTGCAAGGG - Intronic
1055799612 9:80020757-80020779 TCTGTCATTTCTGTGTGATCAGG + Intergenic
1056822117 9:89850376-89850398 ACTGTCACTTGTGTTTGCAGTGG - Intergenic
1057052145 9:91933521-91933543 TCTGTCATTTATGTATACATTGG - Intronic
1057929470 9:99180997-99181019 TTTCTCATTTTTCTTTGCAATGG + Intergenic
1058877037 9:109253241-109253263 TCTGTCATTAGTGTTTGCCGTGG - Intronic
1061896033 9:133648146-133648168 TCCCTCTTTTCTGTATGCAAGGG + Intronic
1186138820 X:6549240-6549262 TCTGTCATTTGTCCTTGTAATGG + Intergenic
1186506961 X:10101213-10101235 TCTGTCTTCTCTGTCTGGAATGG + Intronic
1189164863 X:38850645-38850667 TTTTTCATTTCTGTTAGTAAGGG - Intergenic
1193137879 X:77993214-77993236 TCTGTCATTACAGTAAGCAAGGG + Intronic
1194581610 X:95679116-95679138 TTAGTCATTTTTGTTTACAACGG + Intergenic
1195408882 X:104547508-104547530 TCTTTGCTCTCTGTTTGCAATGG - Intergenic
1196011247 X:110890199-110890221 TCTTTCATTTCGTTGTGCAATGG - Intergenic
1196235335 X:113273462-113273484 TCTGTCAGGTCTGTTTGAGAGGG - Intergenic
1197029142 X:121792543-121792565 TCTGGCATATGTGTATGCAATGG - Intergenic
1197217242 X:123878051-123878073 TAAGTCATTTCTGTTTGAAGTGG - Intronic
1197740009 X:129883827-129883849 TCTTTCTTTTCTGATTGCACTGG + Intergenic
1198214133 X:134541775-134541797 TCTATCATTATTATTTGCAATGG + Intergenic
1200455928 Y:3392522-3392544 TCTTAAATTTCTGTTTTCAAGGG + Intergenic
1201328526 Y:12793244-12793266 TCATTCATTTCTGCTTGGAACGG - Intronic
1202297607 Y:23376474-23376496 TCTGGCATTTATGGTAGCAATGG + Intergenic
1202573202 Y:26294123-26294145 TCTGGCATTTATGGTAGCAATGG - Intergenic