ID: 981931246

View in Genome Browser
Species Human (GRCh38)
Location 4:150191345-150191367
Sequence ATCTGTCATTTCTGTTTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 352}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981931246_981931255 30 Left 981931246 4:150191345-150191367 CCTTGCAAACAGAAATGACAGAT 0: 1
1: 0
2: 1
3: 29
4: 352
Right 981931255 4:150191398-150191420 ACCTGTTCCAGGGCCATGTCAGG 0: 1
1: 0
2: 2
3: 14
4: 172
981931246_981931250 -8 Left 981931246 4:150191345-150191367 CCTTGCAAACAGAAATGACAGAT 0: 1
1: 0
2: 1
3: 29
4: 352
Right 981931250 4:150191360-150191382 TGACAGATTCCAGGGAGTGGTGG No data
981931246_981931251 0 Left 981931246 4:150191345-150191367 CCTTGCAAACAGAAATGACAGAT 0: 1
1: 0
2: 1
3: 29
4: 352
Right 981931251 4:150191368-150191390 TCCAGGGAGTGGTGGAAGATAGG 0: 1
1: 0
2: 3
3: 25
4: 338
981931246_981931254 20 Left 981931246 4:150191345-150191367 CCTTGCAAACAGAAATGACAGAT 0: 1
1: 0
2: 1
3: 29
4: 352
Right 981931254 4:150191388-150191410 AGGTTAGCAAACCTGTTCCAGGG No data
981931246_981931253 19 Left 981931246 4:150191345-150191367 CCTTGCAAACAGAAATGACAGAT 0: 1
1: 0
2: 1
3: 29
4: 352
Right 981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG 0: 1
1: 0
2: 0
3: 1
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981931246 Original CRISPR ATCTGTCATTTCTGTTTGCA AGG (reversed) Intronic
900475552 1:2874827-2874849 CTCTATCACTCCTGTTTGCAGGG + Intergenic
901136039 1:6996451-6996473 ATCTCTGAATTATGTTTGCATGG - Intronic
902853246 1:19178587-19178609 ATTTGCCATTTTTGTTTACATGG - Intronic
903650848 1:24921216-24921238 ATCTCACAGTTCTCTTTGCATGG + Intronic
904920386 1:34003387-34003409 TTCTGTCATTGCTTTTTACAAGG + Intronic
906573453 1:46864963-46864985 ATTTTTGGTTTCTGTTTGCATGG - Intergenic
906598417 1:47102077-47102099 ATTTTTGGTTTCTGTTTGCATGG + Intronic
907370724 1:54001654-54001676 GTCTGCCATCACTGTTTGCAGGG - Intergenic
907411842 1:54288629-54288651 AGATGTCATTTCTGTTTTCCTGG + Intronic
907658602 1:56370779-56370801 CTCTTTCATTGCTGTTTCCAAGG + Intergenic
910380166 1:86618377-86618399 ATCTGTCATACCAGTGTGCATGG - Intergenic
910922328 1:92362112-92362134 AACTTTCATTTAAGTTTGCAAGG - Intronic
911247328 1:95532899-95532921 TTCTGTGGGTTCTGTTTGCATGG + Intergenic
912072845 1:105834654-105834676 ATCTATCATTTCTGTGTGTTGGG - Intergenic
913315971 1:117552225-117552247 ATTTTTGTTTTCTGTTTGCATGG - Intergenic
913649817 1:120902344-120902366 ATCTGTTATTTCTGTATGATTGG - Intergenic
914372398 1:147039752-147039774 ATCTGCCATTTCAGTTTCAATGG - Intergenic
914577104 1:148983021-148983043 ATCTGCCATTTCAGTTTCAATGG + Intronic
914684555 1:149966972-149966994 ATTGGTCATTTCTGTTCACAAGG + Intronic
915746394 1:158162741-158162763 CTCTGTCATTATTGTTTGCAGGG + Intergenic
917782318 1:178411508-178411530 ATAGGTCATGTCTGATTGCATGG - Intronic
918385647 1:184004991-184005013 AGCTGTCATTTCTTTTAACAAGG + Intronic
918647992 1:186924386-186924408 ATCTGTCATTTGCATCTGCAAGG - Intronic
919401399 1:197122008-197122030 ATTTGTCATTTCTTTGTGCAAGG - Exonic
919555586 1:199048241-199048263 TTTTTTCTTTTCTGTTTGCATGG - Intergenic
919569195 1:199224410-199224432 ATCTGACATTTCAGTATCCAAGG + Intergenic
923832391 1:237572338-237572360 ATGTGTGAGTTCTGTTTGTATGG + Intronic
924146151 1:241076871-241076893 AACTGTCATTTTTGTTCTCATGG + Intronic
1064650919 10:17508511-17508533 ATAGCTCATTCCTGTTTGCAGGG + Intergenic
1064932658 10:20644031-20644053 ACCTGTCATTTCAATCTGCATGG - Intergenic
1065095751 10:22279034-22279056 AGTTGTCTTTTCTCTTTGCATGG - Intergenic
1065462792 10:25986691-25986713 ATCTGTGATTTCTTTCAGCACGG - Intronic
1065930410 10:30473868-30473890 AGCTGACATAGCTGTTTGCAGGG + Intergenic
1067545831 10:47192258-47192280 ACCTGTCATCTCAGTTTCCAGGG + Intergenic
1067787862 10:49263942-49263964 TTCTCTCATTTCAGTTTGTATGG - Intergenic
1069629312 10:69888283-69888305 ATCTGGCCTTTCTGGTTTCAGGG + Exonic
1069939730 10:71946742-71946764 ATTTGTCATCTCCGTTTCCATGG + Intergenic
1070103032 10:73406294-73406316 TTCTGTAATTTCTGTTCTCATGG + Intronic
1071322771 10:84480801-84480823 ATCTGTCATCTCTATTTAGATGG + Intronic
1071355925 10:84795171-84795193 ATTTGTGATTTCACTTTGCATGG + Intergenic
1071548295 10:86545359-86545381 ATCTGTCATCCCTTTTGGCAGGG - Intergenic
1073770956 10:106735183-106735205 ATAGATCATTTCTGTTAGCAAGG - Intronic
1075610419 10:123850341-123850363 ATCTGTGGTTTCTCTTTCCATGG + Intronic
1075957213 10:126534359-126534381 CTCTGCCATTTCTGTTTCTATGG + Intronic
1078772332 11:14362482-14362504 TTCAGTGATTTGTGTTTGCATGG - Intronic
1078962722 11:16297622-16297644 GTCTGTCATTTCTGTTTGAATGG - Intronic
1080562665 11:33478253-33478275 CTCTGTGAGTTCTGTTAGCATGG - Intergenic
1080712864 11:34767569-34767591 ATTTTTGGTTTCTGTTTGCATGG + Intergenic
1080835251 11:35934728-35934750 ATCTATCATTTCTATGTGCTGGG - Intergenic
1085457807 11:76675148-76675170 ATCTGTCATATTTCTTGGCATGG - Intergenic
1085465195 11:76718363-76718385 ATCTGCAATTTCTCTTTCCATGG + Intergenic
1085808812 11:79661559-79661581 ATCTGTCATTTTTGTTGTCATGG - Intergenic
1086071173 11:82801305-82801327 ATTTTTTGTTTCTGTTTGCATGG + Intergenic
1086503496 11:87478189-87478211 TTCTGGCATTTTTATTTGCAAGG - Intergenic
1087009473 11:93499702-93499724 ATCAGTGATTTTTGATTGCAGGG - Intronic
1090416698 11:126545387-126545409 ATCTGTCCTTGCTGCTTTCAGGG + Intronic
1091510184 12:1115135-1115157 AGATGTAATTTCTGTTTACATGG + Intronic
1093122753 12:15292419-15292441 AAATGTCTTTTCTGTCTGCAGGG + Intronic
1094090824 12:26647161-26647183 ATCTGTGCTTGCTGTTTGAACGG - Intronic
1095264495 12:40138193-40138215 TTCAGTCAATTCTGTTTGAATGG + Intergenic
1096376135 12:51112288-51112310 ATCTGTCATTTCTTTGTGTTGGG + Intronic
1097517910 12:60628729-60628751 ATCTGTGATTTCAGCTTTCATGG + Intergenic
1097563462 12:61238004-61238026 ATTTCTCATTTATGTTTGAAGGG + Intergenic
1099023866 12:77441382-77441404 ATATGGCATGTGTGTTTGCAGGG - Intergenic
1099409645 12:82309312-82309334 TTCTTTGATTTGTGTTTGCATGG - Intronic
1099847255 12:88043774-88043796 TTCTGTAATTTCTGATTGAATGG - Intronic
1101172662 12:102115058-102115080 ATTTGTCATCTCTATTTGAATGG - Intronic
1101215638 12:102579126-102579148 TTCTGTCATTTCCCTTTGTATGG - Intergenic
1101630819 12:106492645-106492667 ATTTGTTATTTCTATTTCCAAGG - Intronic
1102096876 12:110247866-110247888 ATCTGTCATCTCTGCCTGCTGGG + Intergenic
1103415067 12:120738028-120738050 TGCTGTCATTTCTGTTTCTAGGG + Intronic
1104653069 12:130551395-130551417 ATCTGTCTTATCTGTGTTCATGG + Intronic
1105341146 13:19527321-19527343 ATTTGTCATTTCTGTATGTTGGG - Intronic
1106406556 13:29479858-29479880 ATCTGGGCTTTCTGATTGCAAGG - Intronic
1106960141 13:34988765-34988787 ATCTGTCTTGTTTATTTGCATGG + Intronic
1107379785 13:39844739-39844761 ATCTGACTTTTCTGTTAGAAAGG + Intergenic
1107639133 13:42423346-42423368 ATCTGTCATTACTGTGTGTTAGG - Intergenic
1107807681 13:44169969-44169991 TTTTTTCATTTCTGTTGGCATGG + Intergenic
1109090519 13:58037890-58037912 AACTGTCATTTGAGTTTACAGGG - Intergenic
1109225940 13:59695444-59695466 ACCTTTTATTTCTGTTTGAAGGG - Intronic
1109369445 13:61402605-61402627 ATATGTCAATTATATTTGCAAGG + Intergenic
1109427939 13:62192609-62192631 ATTTGTCATTTCTGTATGTTGGG + Intergenic
1109963594 13:69663022-69663044 ATCAGCCATTTCCTTTTGCAAGG + Intergenic
1110816990 13:79872571-79872593 ATTATTCATTTCTGTTTGGATGG + Intergenic
1111369300 13:87295854-87295876 ATCTGTCTCTTCAGTTTTCAGGG - Intergenic
1111975823 13:94966584-94966606 ATCTGTGATTACTTTGTGCAGGG - Intergenic
1112532600 13:100219418-100219440 ATCTGGAAATTCTGTTTACACGG + Intronic
1113148696 13:107238332-107238354 ATCAGTAAATGCTGTTTGCAAGG + Intronic
1113465650 13:110511051-110511073 ATATCTCAGTTCAGTTTGCAGGG - Intronic
1115033789 14:28831985-28832007 ATTTAAAATTTCTGTTTGCAGGG + Intergenic
1115066131 14:29262973-29262995 ATTTTTCATTTCTGTTACCATGG + Intergenic
1116327655 14:43552338-43552360 ATCTGTCAGTTCTGTTTGTGAGG - Intergenic
1116600411 14:46915327-46915349 ATTTGTCATTTCTGTGTGTTGGG - Intronic
1119613209 14:76081264-76081286 ATCTTTCATTTCTGCTTTCATGG - Intronic
1121962112 14:98270498-98270520 ATAAGTCATTATTGTTTGCAAGG - Intergenic
1123464254 15:20503083-20503105 ATCTGCAATTCCTGTCTGCAGGG + Intergenic
1123653810 15:22497339-22497361 ATCTGCAATTCCTGTCTGCAGGG - Intergenic
1124274981 15:28319061-28319083 ATCTGCAATTCCTGTCTGCAGGG + Intronic
1124307717 15:28592535-28592557 ATCTGCAATTCCTGTCTGCAGGG - Intergenic
1124604722 15:31161636-31161658 CTGTGTCATTTCTGATTTCAGGG + Intergenic
1125287861 15:38113217-38113239 ATCTTTCTTCTCTGTTTGCCAGG + Intergenic
1125781367 15:42272122-42272144 ATCTTTCCTTTATGTTTGCAGGG - Exonic
1126832694 15:52624559-52624581 ATCTGTCCTTTCCTTTTTCATGG - Intronic
1127234706 15:57036347-57036369 ATCTGGCATTTCTCTTTGGTAGG + Intronic
1128653789 15:69442728-69442750 ATATCTCATTACGGTTTGCAAGG - Intronic
1131088893 15:89603949-89603971 ATCTGTGATTTCACTTTCCATGG - Intronic
1131767753 15:95699174-95699196 CTCTATCACTTCTGTTTGGAAGG + Intergenic
1132687226 16:1167385-1167407 ATCTGGCGTGTGTGTTTGCACGG + Intronic
1133343397 16:5053878-5053900 ATCTGTCATTTCTTTGTGTTGGG - Intronic
1133858016 16:9567706-9567728 GCCTGTTATTTCTGTTTCCATGG - Intergenic
1133865084 16:9634809-9634831 ATTTGTCATTTCCTTTTCCAGGG + Intergenic
1135764853 16:25168709-25168731 ATCTGTCTTCTCTGTTTTCATGG + Intronic
1138033776 16:53581787-53581809 ATCTTTCATTTATGTGTACATGG + Intergenic
1139480523 16:67228039-67228061 ATCTCTCATTTCTTTTTGACTGG - Intronic
1140023133 16:71258672-71258694 GTCTGTCATTTCTGATTCAAGGG - Intergenic
1140875586 16:79149793-79149815 ATCACTCAGTTCTGTTGGCATGG + Intronic
1147641540 17:42004601-42004623 ATCTGTCCTCTCTGGATGCATGG + Intronic
1148877756 17:50701570-50701592 ATCTTTCATTTCTGTTAAGATGG - Intronic
1150174534 17:63037429-63037451 ATCTGTGATTTCTCTTTCTATGG - Intronic
1150580251 17:66467050-66467072 CTCTGTCGTGTGTGTTTGCAGGG - Intronic
1152857028 17:82670873-82670895 ATCTTTCGTTTCTGTTTTCATGG + Intronic
1153123929 18:1766404-1766426 GTCTTTCATTTCTGTATTCATGG + Intergenic
1153653432 18:7261531-7261553 CTCTTTCATTTCTGTCTGCCAGG - Intergenic
1153794235 18:8608572-8608594 TTTTGCCATTTCTGTTTGGAAGG - Intergenic
1154304729 18:13222263-13222285 AGGGATCATTTCTGTTTGCATGG + Intronic
1154308547 18:13248739-13248761 ATTTGTCATTTCTTTGTGCTGGG + Intronic
1155232796 18:23791226-23791248 TACTGTCCTTTCTCTTTGCAGGG - Intronic
1155750613 18:29418491-29418513 ATCTGTTGTTTCACTTTGCAAGG - Intergenic
1156261200 18:35446290-35446312 TTCTGTCTTTTCTTTTTCCAGGG - Intronic
1156379032 18:36540771-36540793 ATCTGGCATCTCTGCTTCCAGGG + Intronic
1156644004 18:39137621-39137643 ATTTGTCATTTTTGTGGGCATGG - Intergenic
1156859838 18:41823114-41823136 AACTGTCTTGTCTATTTGCAAGG + Intergenic
1157244344 18:46040273-46040295 ATCCCTAATTTCTGGTTGCAGGG - Intronic
1157798998 18:50603196-50603218 CCCTGTCATTTCTGTTCTCAAGG + Intronic
1157957409 18:52113753-52113775 GTCTCTCATATCTGTTTGCTAGG + Intergenic
1158447183 18:57531764-57531786 ATCTTTCCTTTCTGATCGCATGG - Intergenic
1158683737 18:59593927-59593949 ATATGTCATTGCTGTTGGAATGG - Intronic
1158888008 18:61847291-61847313 ATGTGCTATTTCTATTTGCATGG + Intronic
1158918509 18:62162512-62162534 ATGTTTCATTTGTTTTTGCAAGG - Intronic
1158925998 18:62261303-62261325 ATCAGTCATTTCCATTTGTAGGG - Intronic
1158933201 18:62341094-62341116 ATCTGTGATTTCTGTTAACTAGG - Intronic
1164760659 19:30726106-30726128 CTCTCTCATTTCTGTTTCCTGGG + Intergenic
1164900043 19:31910612-31910634 ATCTGACTTTTCTGTTTTCAGGG - Intergenic
1165722633 19:38090570-38090592 CTCTGTCATTTCTGCTTCCCTGG - Intronic
925878363 2:8330574-8330596 ATCTGTCATTTCCGTGTGTTGGG - Intergenic
926469000 2:13229469-13229491 ATCTGTCATTTATGATTGCTTGG - Intergenic
926877366 2:17496302-17496324 ATTTCTCTATTCTGTTTGCAGGG + Intergenic
926982057 2:18583541-18583563 AGGTGTCATTTGTTTTTGCATGG + Intronic
927245428 2:20953634-20953656 ATGTGTGTTTTCTGTCTGCATGG + Intergenic
930662411 2:54068097-54068119 ATCTGATATTTCTGTGTGGAGGG + Intronic
931207588 2:60163049-60163071 ATCAGTCATTTCTGCTTCAATGG + Intergenic
931295289 2:60918124-60918146 ATATTTTATTTCTTTTTGCAGGG - Intronic
931382969 2:61770550-61770572 TCCTGTGATTTCTGTCTGCATGG - Intergenic
931554047 2:63480215-63480237 ATCTGTGATTTCTTTCAGCAGGG - Intronic
932093327 2:68825772-68825794 ATTTGTCATTTTTTTTTGGATGG - Intronic
932445104 2:71775866-71775888 ATCTGTCATTCCTGTATGCTGGG + Intergenic
932516560 2:72356767-72356789 ATCTGCCATTTCACTTTCCATGG + Intronic
933429152 2:82152717-82152739 ATCTGTCATGTCTCTCTGTAAGG - Intergenic
933532192 2:83524658-83524680 TTTTGTGATTTATGTTTGCATGG - Intergenic
935175576 2:100645935-100645957 TTCTGTAAGTTCTGTTTCCAGGG + Intergenic
935840865 2:107109050-107109072 ACCTGTCATTCCAGGTTGCATGG - Intergenic
936015005 2:108951352-108951374 ATCAGTTATTTCTGTTAGCTGGG + Intronic
937419631 2:121742939-121742961 ATCTGTCATTTCTATTTTTATGG - Intronic
937835226 2:126464647-126464669 ATCTGTGAGTTCTGTATCCATGG + Intergenic
938237088 2:129714253-129714275 AACTGTAATTTCTATTTGAATGG - Intergenic
938301840 2:130220388-130220410 AGCTGTCCTTTCTGTTTCCTTGG - Intergenic
938454860 2:131454063-131454085 AGCTGTCCTTTCTGTTTCCTTGG + Intergenic
939143319 2:138380445-138380467 TTCTTTCATTTTTATTTGCATGG - Intergenic
939471016 2:142619865-142619887 ATTTGTCATTTCTGGTAGAAAGG + Intergenic
939600177 2:144178942-144178964 ATTTGTAATTTCTGATTGCCTGG + Intronic
941945774 2:171095343-171095365 ATTTGTCAATTTTGTTTTCAAGG - Intronic
942659712 2:178251447-178251469 GTGTGCCATTTCTGCTTGCAAGG + Intronic
943751911 2:191518016-191518038 TTCTTTCATTTCTGTTTCAATGG - Intergenic
944331897 2:198478848-198478870 ATCTGCCACTTCTGTTTACTAGG + Intronic
947817888 2:233050197-233050219 ATCTGACACTTCTGTGTGCTGGG + Intergenic
948004986 2:234600915-234600937 ATCTGGCATCTGTCTTTGCAGGG - Intergenic
948179533 2:235968742-235968764 GTATGTGCTTTCTGTTTGCAAGG + Intronic
1169138177 20:3210163-3210185 ATCTAAAGTTTCTGTTTGCAGGG + Intronic
1170495676 20:16922420-16922442 ATCTCTCATTTCATTCTGCATGG - Intergenic
1170688838 20:18593833-18593855 TTCTGTCATTGCTGTTTGAGTGG + Intronic
1170871979 20:20214377-20214399 TCCTGCCATTTCTGTTTGCAGGG - Intronic
1171060568 20:21954867-21954889 GCTTTTCATTTCTGTTTGCATGG + Intergenic
1171800922 20:29616217-29616239 ATCTATGATTACTTTTTGCATGG + Intergenic
1173173406 20:40745495-40745517 TTCTGCCATTTCTCTTAGCACGG - Intergenic
1173640973 20:44601601-44601623 CCCTGGCATTTCTGTTTCCACGG + Intronic
1173710191 20:45148781-45148803 ATATGTCATTTCTCTTTGCTAGG - Intergenic
1175343639 20:58252790-58252812 ATCTGTGATTTCTTTGGGCAGGG - Intergenic
1175461035 20:59152125-59152147 ATTAGTCATTGCTGTTTGCCAGG + Intergenic
1177203262 21:17981455-17981477 AGCTGTCACTTCTGTTTCCATGG - Intronic
1177453045 21:21296851-21296873 ATTGGTCATTTTTGCTTGCATGG - Intronic
1177696562 21:24580465-24580487 AACTGTCTTTTCTGTTTGTTAGG + Intergenic
1177862385 21:26469609-26469631 ATTTGTCATTTCTTTATGCTGGG + Intronic
1179363528 21:40734505-40734527 TTCTGTCCTTTGTGTATGCATGG - Intronic
1180692901 22:17732282-17732304 ATCTTCCCTTTCTTTTTGCAAGG + Intergenic
1181611932 22:24020882-24020904 ATATATCATTTCTGTTATCAAGG + Intronic
1182139239 22:27938517-27938539 ACCTTTCTTTTCTGTTTGCATGG + Intergenic
1185114200 22:48922098-48922120 ATCTGTCTTTCCAGATTGCAGGG - Intergenic
1185188005 22:49414485-49414507 GTGTGCCATTTCTGTTTGGAAGG - Intergenic
949901891 3:8822046-8822068 ATGTGAAATTTCTGTTTCCAAGG + Intronic
950735042 3:15000322-15000344 TTCTGTCATTTCTGATGACACGG - Intronic
951275509 3:20680555-20680577 TTCTGTCATTTCTGGTTGATTGG - Intergenic
951337604 3:21443662-21443684 ATATGTGATTACTTTTTGCATGG - Intronic
951913911 3:27779530-27779552 ATCTGTCATTTTTCCTTGAATGG - Intergenic
952229781 3:31417896-31417918 ATTTATCATTTCTTTGTGCAGGG - Intergenic
952523658 3:34187026-34187048 ATCTATCATTTCTTTTTCAAGGG + Intergenic
953615076 3:44482719-44482741 ATCTGTCTGTCCTGGTTGCAGGG - Intergenic
954135888 3:48581942-48581964 ATCTGTCCTGTTTGTTTTCAGGG - Exonic
954345939 3:49999376-49999398 GTGTGTCTTTTGTGTTTGCAAGG + Intronic
955434628 3:58889454-58889476 TCCTCTCAGTTCTGTTTGCATGG - Intronic
956052783 3:65266382-65266404 ATCTGTTGTTTGTGTTTGCCTGG - Intergenic
956741131 3:72277048-72277070 ATCTGTTATTTCTGTTTGTCTGG - Intergenic
956904670 3:73753366-73753388 TTTTGTCTTTTCTGTTTGGATGG - Intergenic
957019133 3:75104710-75104732 ATCCATCATTCCTGTTTTCAAGG + Intergenic
960119820 3:113936453-113936475 ATCTTTCATCTCTGTTTACCAGG - Intronic
960760412 3:121067904-121067926 ATCTTTACTTTGTGTTTGCATGG + Intronic
960851444 3:122059039-122059061 ATCTGTCTTTTCTCTCTGCCTGG - Intronic
962346116 3:134620098-134620120 CACTCTCATTTGTGTTTGCAAGG + Intronic
963403890 3:144838514-144838536 ATCTCTCCTTTATGTTTGAAGGG + Intergenic
963533846 3:146503524-146503546 ATCTATCCTTTCTGTTTACCAGG - Intergenic
963680404 3:148367939-148367961 TTATGTCATTTCTTTTGGCAAGG - Intergenic
963829945 3:149995793-149995815 ATTTTTGGTTTCTGTTTGCATGG - Intronic
964350143 3:155794696-155794718 TTCTGCAGTTTCTGTTTGCATGG - Intronic
965294636 3:166928019-166928041 TTCTGGCATTTCTTTGTGCAGGG + Intergenic
966694416 3:182775794-182775816 ATTTTTGGTTTCTGTTTGCATGG + Intergenic
966791373 3:183673508-183673530 ATCTGTTATTTCTGTTGTAAAGG + Intronic
967203653 3:187099345-187099367 ATCTGTGATTTCTTTCAGCAGGG - Intergenic
967242348 3:187452851-187452873 ATCTGCCTATTCTGTTTTCATGG + Intergenic
967311706 3:188112284-188112306 CTGTGTGATTTCTATTTGCAAGG - Intergenic
970064001 4:12070268-12070290 ATATCTCATTTTTGTTTGGAAGG - Intergenic
971251379 4:24975768-24975790 ATCTGTGGTTTCTGCTTGCCTGG - Intronic
971251576 4:24977050-24977072 ATCTGTGGTTTCTGCTTGCCCGG + Intronic
971562013 4:28090551-28090573 TTCTGTCATTTCTGTTTCCTTGG + Intergenic
972099570 4:35396911-35396933 ATCTGTTATTTCAGTTTTTATGG + Intergenic
973589877 4:52430355-52430377 ATTTTTCATTTCAGTTTTCAAGG - Intergenic
974274584 4:59701787-59701809 ATCTGTCATTTCTTTGTCAACGG + Intergenic
974553725 4:63415225-63415247 ATATGTCATTTATCTTTGAATGG - Intergenic
975678852 4:76855134-76855156 ATCTGGCATTTCTATTTTTAGGG - Intergenic
976217057 4:82725454-82725476 AGCTGTCATTTTTGTTTGTTTGG - Intronic
976371697 4:84296730-84296752 ATTTTTGGTTTCTGTTTGCACGG - Intergenic
978329171 4:107593531-107593553 CTGTGTCCTTTCTGTTTCCAAGG + Intronic
978804626 4:112787382-112787404 ATCAGGCTTTTTTGTTTGCAAGG + Intergenic
978976608 4:114883076-114883098 ATCTGACTTTTCTTTTTTCAAGG - Intronic
979645940 4:123069083-123069105 ATCTATCATTTCTGTATACTTGG - Intronic
981879986 4:149598422-149598444 ATCTTTCATTTCTGCTAGCTTGG - Intergenic
981913208 4:150006363-150006385 ATCTGGCATTACTGCTTGAAAGG - Intergenic
981917901 4:150054791-150054813 ATGTATCATGTCTGTTTGAATGG + Intergenic
981931246 4:150191345-150191367 ATCTGTCATTTCTGTTTGCAAGG - Intronic
982714605 4:158793688-158793710 TCCTCTCAGTTCTGTTTGCATGG + Intronic
985230819 4:187814634-187814656 ACCTGACATTTCTGTTGGGATGG - Intergenic
986166341 5:5274861-5274883 ATTTTTCATTTCTGTTTTCTGGG + Intronic
986885393 5:12227419-12227441 ATATCTCATTTTTGTTTGGATGG + Intergenic
987618735 5:20310847-20310869 ATCTGTCATTGCTGTTTTTCTGG + Intronic
990815643 5:59781979-59782001 TTCTGTTATTTCTGTTTGTGAGG - Intronic
991088137 5:62667193-62667215 ATCTGGGCTTTCTGCTTGCAAGG + Intergenic
991542303 5:67743002-67743024 ATCTGTTATCTTTGTGTGCATGG + Intergenic
992273922 5:75095128-75095150 ATCTGTAATTTCATTTTCCATGG + Intronic
992939207 5:81746487-81746509 GTTTGTCATTTTTCTTTGCAGGG + Intronic
993372827 5:87113929-87113951 ATCTGTGGTTTCAGTTTCCATGG + Intergenic
993881873 5:93372512-93372534 ATGTGTGATTTCAGCTTGCATGG - Intergenic
994077083 5:95665530-95665552 TTCTGTCATTTGTGATGGCAAGG - Intronic
994232795 5:97328181-97328203 TTCTGTCTGTCCTGTTTGCATGG + Intergenic
995436182 5:112138271-112138293 TTGTGTCCTTGCTGTTTGCAAGG - Intergenic
995478435 5:112571152-112571174 TTCTGTCATTTGTATCTGCAAGG - Intergenic
995584971 5:113639377-113639399 CTCTGTCAATTCTCTTTCCAAGG + Intergenic
996403044 5:123083984-123084006 ATATATCCTTTCCGTTTGCAGGG - Intergenic
996991641 5:129640207-129640229 ATCTGTCATTTCTTTGTGTTAGG + Intronic
997015119 5:129923676-129923698 ATCTGCCAATTGTGTTTCCAAGG - Intronic
997704576 5:135935703-135935725 ATTCATCATTTCTGTTTGGAGGG + Intronic
997760410 5:136442768-136442790 TTCTTTGATTACTGTTTGCATGG + Intergenic
998924926 5:147112637-147112659 TTCTGTCATTGCTGTTTCAAGGG - Intergenic
999443994 5:151624237-151624259 CCCTGAGATTTCTGTTTGCAGGG + Intergenic
999955080 5:156691699-156691721 ATCTGTCATCTGTTTTTGCATGG - Intronic
1000108466 5:158083614-158083636 ATCCTTCATGTCTGTTTGCTAGG + Intergenic
1000286756 5:159833496-159833518 ACGTGTCATGTCTGTCTGCATGG + Intergenic
1000577943 5:162998780-162998802 ATCTGTCATTTCTGCATCAAAGG - Intergenic
1000610560 5:163369020-163369042 TTCTGTCATTAGTGGTTGCATGG + Intergenic
1005286241 6:24330149-24330171 AGCAGTCAGTTTTGTTTGCAAGG + Intronic
1007500200 6:42291116-42291138 AACTGTCTTCTCTGTTTGAAAGG + Intronic
1008100802 6:47389033-47389055 TTTTTTTATTTCTGTTTGCATGG + Intergenic
1008484979 6:52025874-52025896 ATTTGTGATTTCTCCTTGCATGG + Exonic
1008718008 6:54312774-54312796 ATCTGACAATTCTGCGTGCAAGG + Intronic
1009058571 6:58369743-58369765 AATTTTGATTTCTGTTTGCATGG - Intergenic
1009232267 6:61077375-61077397 AATTTTGATTTCTGTTTGCATGG + Intergenic
1009292905 6:61906373-61906395 ATCTGTCATTTCTTTGTGTTAGG + Intronic
1009576262 6:65465502-65465524 ATCTGTCTTTTTTGTTTGTTTGG - Intronic
1009927743 6:70140422-70140444 ATCTGTAAGTTCTGTGTCCATGG - Intronic
1011621506 6:89248120-89248142 ATCTGTCATATCTGTGTTCTGGG - Intergenic
1011825848 6:91304356-91304378 ATTTATCCTTTCTCTTTGCATGG + Intergenic
1011917704 6:92528847-92528869 AATTTTGATTTCTGTTTGCATGG - Intergenic
1012573931 6:100766658-100766680 ATCTGTCATTTCAGCTGCCAAGG + Exonic
1012948164 6:105489765-105489787 ATCTGTCCTTTCTGCTTTCCTGG + Intergenic
1014538303 6:122643934-122643956 ATATGTCAGTTCTGTTTGTGTGG + Intronic
1014950407 6:127547737-127547759 ATCTGGCACTTTTATTTGCAAGG - Intronic
1014966319 6:127757389-127757411 ATCTGCCATTTATGTATGCACGG - Intronic
1015342481 6:132117685-132117707 AGCTCTCACTTCTGTTTACATGG - Intergenic
1019161811 6:170073983-170074005 TTCTCTGATTTGTGTTTGCATGG - Intergenic
1020540518 7:9457520-9457542 CTTTTTCTTTTCTGTTTGCATGG + Intergenic
1020700771 7:11479929-11479951 ATTTATCATTTCTTTTAGCAAGG - Intronic
1021580497 7:22147838-22147860 CTATGTCATTTATTTTTGCAAGG - Intronic
1022263350 7:28728897-28728919 ATCTGTCATTTTTTTTTTCCTGG + Intronic
1023658424 7:42449209-42449231 ATCATTCATTTCTCTTTACAAGG - Intergenic
1024322133 7:48081421-48081443 ATATGTCAGTTCTGTTTGTGTGG - Intergenic
1025160699 7:56657685-56657707 TTTTTTGATTTCTGTTTGCATGG - Intergenic
1025768219 7:64478639-64478661 ATCTGTGATTTCTCTCAGCAGGG + Intergenic
1026237687 7:68542447-68542469 ATTTCTCATTCATGTTTGCAGGG - Intergenic
1026392472 7:69915650-69915672 TTCTATCATTTCTGTTTTCTTGG + Intronic
1027721987 7:81754929-81754951 CTCTGTCCTTGCTGTTGGCAAGG + Intronic
1028362948 7:89991036-89991058 AGGTGTCATTTCTTCTTGCAAGG + Intergenic
1028614885 7:92755189-92755211 ATGTGTCTTTCCTGTTAGCAAGG - Intronic
1030962248 7:115940006-115940028 ATCTGTCACTTGTGGTTGAAAGG - Exonic
1031791059 7:126105057-126105079 AGTTTTCTTTTCTGTTTGCATGG - Intergenic
1032434862 7:131891943-131891965 AGCAGACATTTCTGTTTGCAGGG + Intergenic
1032517472 7:132517888-132517910 ATGTGTCCATTTTGTTTGCATGG - Intronic
1034038740 7:147853561-147853583 ATATGTTATTTCTGTTTAAAAGG + Intronic
1034066949 7:148146160-148146182 ATCTGTCATTTTTTTTTCCTGGG - Intronic
1034755062 7:153608876-153608898 ATATGTTATTTCTGTTTTCAGGG - Intergenic
1035097794 7:156369677-156369699 ATCTGTGATTTCACTTTCCATGG + Intergenic
1035419371 7:158713898-158713920 ATCTGTCTTTTCTGTCTGAAAGG - Intergenic
1035604770 8:922684-922706 ATCTGACACTTCTGTTTAAAGGG - Intergenic
1036465004 8:8988676-8988698 ATCTGTCATTTCTTTGTGTTAGG + Intergenic
1037962906 8:23112623-23112645 TTCTGTCATTTGTGTCAGCATGG - Intronic
1038257782 8:25966451-25966473 ATATGCTATTGCTGTTTGCAAGG - Intronic
1038824210 8:30983132-30983154 ATACGGCATTTCTTTTTGCAAGG + Intergenic
1040401635 8:47055949-47055971 ATTTTTGTTTTCTGTTTGCATGG - Intergenic
1041852969 8:62414251-62414273 ATGTGTTATTTCTGTTTCAATGG + Intronic
1042483767 8:69330309-69330331 ATCTGTAATTTCTGATAGCCAGG - Intergenic
1042887444 8:73568151-73568173 ATCTCTTATTTCTGTTGCCAAGG + Intronic
1044462564 8:92462670-92462692 ATCTGTTTATTCTGTTTACATGG + Intergenic
1046447105 8:114337327-114337349 TTCCCTTATTTCTGTTTGCAGGG - Intergenic
1046581703 8:116101127-116101149 GTCTGTCAATTTTGTTTTCAAGG - Intergenic
1047601531 8:126430390-126430412 ATCTGTCAATCCAGTTTTCAAGG - Intergenic
1047811869 8:128419364-128419386 ATATATCATTTTTTTTTGCAAGG + Intergenic
1047989668 8:130273007-130273029 ATTTGTCATTTCTGTGTGTTGGG - Intronic
1049042875 8:140125462-140125484 ATCTGTCATTTCAGAAAGCATGG + Intronic
1049132379 8:140858520-140858542 ACCTGTCTTTTCTGTCTGGATGG - Intronic
1050199272 9:3126086-3126108 TGCTGTCATCTCTGTTTGCCTGG - Intergenic
1050713805 9:8497142-8497164 ATCTGTCATCACAGTTTGCTTGG - Intronic
1051952300 9:22650752-22650774 ATCTGTCATTTCTGTTAAATTGG + Intergenic
1052243295 9:26301869-26301891 ATGAGTCATTTCTGTGTGCTTGG - Intergenic
1052948878 9:34191787-34191809 ATTTGGCATGTCTGTTTCCATGG - Intronic
1054818535 9:69498627-69498649 ATCTGTCATTGCTGTATCCCTGG + Intronic
1054948008 9:70817360-70817382 CTCTGGCATTCCTGTTTGCATGG - Intronic
1055083070 9:72286536-72286558 TTCTTTCATTTCTTTTAGCAAGG + Intergenic
1055084268 9:72298509-72298531 ATCTGTGATTTCACTTTTCAGGG - Intergenic
1055383629 9:75737084-75737106 ATCTATCATTTATATTTGCATGG + Intergenic
1055819848 9:80248611-80248633 ATCTGTTGTTTCACTTTGCATGG - Intergenic
1056389542 9:86127948-86127970 ATATGTCAGTTTTGTTTTCAGGG - Intergenic
1058040970 9:100301522-100301544 AAATGCCATTTCTGTTGGCAGGG + Intergenic
1060498014 9:124132164-124132186 CTCTAGCATTTCTGTTTGCCTGG - Intergenic
1060684013 9:125591638-125591660 ATATGTAATTTCAGTGTGCAAGG - Intronic
1060908402 9:127328867-127328889 ATCTGTCATTCCTGCTTGGATGG - Intronic
1061168474 9:128938339-128938361 ATCTGTTTTTTTTGTTTGCTTGG - Intronic
1185622671 X:1463091-1463113 AGCTCTCATTTTTGTTTACAAGG + Exonic
1185705152 X:2261417-2261439 AGCTGTCATTTCTGTTGGGTGGG + Intronic
1186222307 X:7363125-7363147 ATCTCTCCTTTCTGTTTCTATGG - Intergenic
1186716618 X:12258794-12258816 ATGTATCTTTTCTTTTTGCAGGG + Intronic
1187121895 X:16417268-16417290 AGCTATGATTGCTGTTTGCAAGG - Intergenic
1187797681 X:23022258-23022280 ATCTGGCATTTGTCTTTGGAGGG + Intergenic
1188087211 X:25914317-25914339 ATTTATCTTTACTGTTTGCAAGG - Intergenic
1188168802 X:26894945-26894967 CTCTTTGGTTTCTGTTTGCATGG - Intergenic
1188272380 X:28156468-28156490 ATCTTTCTTTTCTGTAAGCATGG + Intergenic
1188804835 X:34574762-34574784 GTCTGTCATTTCTCATTGCTTGG - Intergenic
1189095236 X:38131543-38131565 ATGTGTTATTTATGTATGCATGG - Intronic
1189514551 X:41699425-41699447 ATTTAGCATTTCTGTTTGTATGG + Intronic
1190650054 X:52560342-52560364 ATCATTCATTTATTTTTGCAGGG + Intergenic
1190842721 X:54160892-54160914 ATCTGTCATTTAAGTTGGAATGG + Intronic
1192657582 X:73008400-73008422 TTCTTTCATTTCTGTTTTCTGGG + Intergenic
1192775152 X:74236923-74236945 ATCTTTCATATGTATTTGCATGG - Intergenic
1193137878 X:77993213-77993235 ATCTGTCATTACAGTAAGCAAGG + Intronic
1193192930 X:78594293-78594315 ATTTTTGGTTTCTGTTTGCATGG + Intergenic
1193296182 X:79833490-79833512 ATTTTTCGTTTCTGTTTGCATGG - Intergenic
1193322310 X:80137191-80137213 CTCTGTGATTTCTATTTGCCAGG - Intergenic
1193763557 X:85496502-85496524 CTCTGTCATTTCTGTTTTCTGGG - Intergenic
1194552312 X:95317180-95317202 ATTTTTGTTTTCTGTTTGCATGG + Intergenic
1196235336 X:113273463-113273485 ATCTGTCAGGTCTGTTTGAGAGG - Intergenic
1196258469 X:113549911-113549933 ATGTGTCATTCCTCTTTGAAAGG - Intergenic
1197265665 X:124368078-124368100 ATTATTCATTTCTGTTAGCATGG + Intronic
1198573094 X:137979206-137979228 AACTGTCATTTCCTTTAGCAAGG + Intergenic
1199016066 X:142817418-142817440 ATCTGTCATTTGTGTCAACATGG - Intergenic
1199385624 X:147219254-147219276 AAATGTCAGTTCTGTTAGCATGG - Intergenic
1199945687 X:152664994-152665016 ATCTGTGATTTCTTTTAGCAGGG + Intergenic
1200830562 Y:7685331-7685353 CTCTGTCATTTCTAGTTTCAGGG - Intergenic
1200900510 Y:8426587-8426609 CACTGTCATTCCTTTTTGCAGGG + Intergenic