ID: 981931253

View in Genome Browser
Species Human (GRCh38)
Location 4:150191387-150191409
Sequence TAGGTTAGCAAACCTGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981931252_981931253 -5 Left 981931252 4:150191369-150191391 CCAGGGAGTGGTGGAAGATAGGT 0: 1
1: 0
2: 1
3: 13
4: 167
Right 981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG 0: 1
1: 0
2: 0
3: 1
4: 84
981931245_981931253 20 Left 981931245 4:150191344-150191366 CCCTTGCAAACAGAAATGACAGA 0: 1
1: 0
2: 2
3: 30
4: 343
Right 981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG 0: 1
1: 0
2: 0
3: 1
4: 84
981931244_981931253 26 Left 981931244 4:150191338-150191360 CCGATACCCTTGCAAACAGAAAT 0: 1
1: 0
2: 3
3: 14
4: 226
Right 981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG 0: 1
1: 0
2: 0
3: 1
4: 84
981931246_981931253 19 Left 981931246 4:150191345-150191367 CCTTGCAAACAGAAATGACAGAT 0: 1
1: 0
2: 1
3: 29
4: 352
Right 981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG 0: 1
1: 0
2: 0
3: 1
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981931253 Original CRISPR TAGGTTAGCAAACCTGTTCC AGG Intronic
902461629 1:16581807-16581829 CAGGACACCAAACCTGTTCCTGG - Intronic
905052352 1:35062564-35062586 TAGGATTACAAACCTGTGCCTGG - Intronic
913251832 1:116918276-116918298 GAGGTTAGAAAACCTGTCCAAGG - Intronic
914719288 1:150276243-150276265 TAGGTTAACAAATCTGTTTTGGG - Intronic
916476438 1:165173877-165173899 TAGGTTCGTAAACCTGATTCTGG - Intergenic
921171238 1:212551692-212551714 TAGGATACCACACCTGTCCCTGG - Intergenic
1065961610 10:30738442-30738464 GAGGTTAGAAAACCTGCTCAAGG - Intergenic
1069847531 10:71383084-71383106 TGGGTTAGGAGTCCTGTTCCAGG + Intergenic
1074426532 10:113356410-113356432 TAGGTCACCAAACCTGTTAGAGG + Intergenic
1074643367 10:115414926-115414948 TAGGTTAACAAATCTATTCGGGG + Intronic
1075466252 10:122652863-122652885 TATGGTAGCTGACCTGTTCCTGG + Intergenic
1076435594 10:130439034-130439056 CAGGTAAGCAAACCTGAGCCTGG - Intergenic
1079170603 11:18091565-18091587 TAGGTTAAGAAAACTGTTCTAGG - Intronic
1088766884 11:112990501-112990523 GAGGTCAGCAACCCTGCTCCGGG + Intronic
1090985254 11:131760807-131760829 GAGCTAAGGAAACCTGTTCCAGG + Intronic
1091028104 11:132159920-132159942 TAGGTGAGCAGGCCTGTTCTGGG + Intronic
1097967022 12:65592172-65592194 TAGGGAAGGAAATCTGTTCCTGG + Intergenic
1102941708 12:116948156-116948178 TAGTTTAGCAAATCATTTCCAGG - Intronic
1111266775 13:85825675-85825697 AATGTAAGCAAATCTGTTCCAGG - Intergenic
1114879453 14:26765983-26766005 TAGGTTAGAAAACCTCTTGATGG - Intergenic
1119451481 14:74715007-74715029 TAAGTTAGCAAACCAGCTCAGGG - Intronic
1127652592 15:61023636-61023658 TAAGACAGCAAACCTGTTGCTGG + Intronic
1135901540 16:26464650-26464672 TAGGTTTGAAAACCTGCCCCAGG - Intergenic
1144677225 17:17169404-17169426 TAGGTTAGCCAACCAGGTGCAGG + Intronic
1151685718 17:75645528-75645550 TTGGTTCCCAAACCTGTTCATGG - Intronic
1155680764 18:28482930-28482952 TTGGTAAGCAAACCTGCCCCAGG - Intergenic
1164824275 19:31273103-31273125 GAGGTTACCAAACCTTTGCCTGG - Intergenic
1166049761 19:40251408-40251430 TAGTTTGCCAACCCTGTTCCTGG + Intronic
1168115317 19:54219021-54219043 CAGTTTAGAAAACCGGTTCCAGG - Intronic
1202678065 1_KI270711v1_random:25554-25576 CAGGACACCAAACCTGTTCCTGG - Intergenic
928103591 2:28453467-28453489 TAGTTTAGCAAACCTGTCTGGGG - Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
935494251 2:103758907-103758929 TAGTTTTATAAACCTGTTCCTGG + Intergenic
937566677 2:123299799-123299821 TAGGTTAGAACACCTCTTCAAGG - Intergenic
941159892 2:162024150-162024172 TATGCCAGCAAACCTCTTCCAGG + Intronic
941645222 2:168033057-168033079 TATGTTGGCAGACCTGTGCCAGG - Intronic
945352405 2:208796809-208796831 TAGGTTCGCATACATGTTCTAGG - Intronic
1169919590 20:10720450-10720472 TAGGTTAGAAAACCTGCTGGAGG - Intergenic
1170160230 20:13303111-13303133 AAGGTTAGCTAACTTGTTCAAGG + Intergenic
1172811408 20:37650714-37650736 GAGGTTAGTTAACTTGTTCCAGG - Intergenic
1176714353 21:10337237-10337259 CGGGTCAGCAAACCAGTTCCAGG + Intergenic
1184648413 22:45908401-45908423 CAGGTGAGCCAACCTGTGCCTGG + Intergenic
949859835 3:8494940-8494962 TAGGTTAAGTAAGCTGTTCCAGG - Intergenic
952752452 3:36836218-36836240 TAGGCCAGCAAGCCTGCTCCTGG + Intronic
953341815 3:42140770-42140792 AAGGTTAGGAAGCCTCTTCCGGG + Intronic
957661725 3:83164587-83164609 GAGTTTAGCAAACCTCTTTCAGG - Intergenic
958884500 3:99710657-99710679 CATGTTAGCACACCTGTGCCTGG - Intronic
966465879 3:180230946-180230968 CAGGTTAGAAAACCTGTACAGGG - Intergenic
969700305 4:8764290-8764312 CAGGTTGGCAAACTTGTTGCTGG + Intergenic
970052551 4:11931134-11931156 AAAGTTAGAAAACCTGTTCTTGG - Intergenic
970106656 4:12593516-12593538 TGTGTTAGAAGACCTGTTCCAGG - Intergenic
980879090 4:138691314-138691336 TAGGTTACCAAACCAGTTAGAGG + Intergenic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
982074561 4:151725631-151725653 TTGCTTAGCAAACCCTTTCCTGG - Intronic
982606667 4:157524513-157524535 CAGGTTAGGAAACCTGTACAGGG + Intergenic
986146663 5:5084254-5084276 CAGGTTAGCAGGCCTGTTACTGG + Intergenic
988233791 5:28512408-28512430 TAGGTTAGAAAAGTTGATCCAGG - Intergenic
994030672 5:95138604-95138626 TTGGTTAGCAGACCTATTCCTGG - Intronic
994121880 5:96123609-96123631 TAGATTAGCAAAACAGTTGCTGG + Intergenic
995045328 5:107640216-107640238 GAGATTAGCCATCCTGTTCCTGG - Intronic
996991205 5:129634611-129634633 TAGGTTTGCAACCTTGTTTCTGG - Intronic
999712939 5:154334443-154334465 TAGGCTGGCAGACCTGTCCCCGG + Intronic
1000249596 5:159481471-159481493 TAGGTCAACAAACCTGCACCAGG + Intergenic
1010160266 6:72845988-72846010 GAGGTTAGGAAGCCTGTTCAGGG + Intronic
1013718678 6:112995467-112995489 AAGTTTTGAAAACCTGTTCCAGG + Intergenic
1015447435 6:133323738-133323760 TAGTATATCAAACCTGTTACTGG - Intronic
1020389013 7:7639298-7639320 TATGTTATCAAATCTGTTCATGG + Intronic
1020555460 7:9664442-9664464 TATTTTTGCAAAGCTGTTCCAGG + Intergenic
1020670832 7:11108744-11108766 TAGTGTAGCAAACTTGTTCTTGG + Intronic
1021932097 7:25591587-25591609 TAGGTTCAAAAACCTGTGCCAGG + Intergenic
1024778408 7:52816383-52816405 GAGGTTGGCAAGCCTGTACCAGG - Intergenic
1028146391 7:87324316-87324338 CAGGTTAGGAACCCTGTTCGGGG + Intergenic
1035721068 8:1792398-1792420 TAGATTAGTTAACCTGTTCTAGG + Intergenic
1035959656 8:4123282-4123304 TAGGTCAACAAACATTTTCCAGG + Intronic
1037564406 8:20105497-20105519 TAGGCAAGCAAACCTGACCCTGG + Intergenic
1038179576 8:25213855-25213877 TTGATTAGTAAACCTGTTACAGG + Intronic
1038248014 8:25877341-25877363 TAGGCTAGCATACCTCCTCCAGG + Intronic
1041256764 8:55985442-55985464 GAGGATAGCAAATCTGTTTCAGG + Intronic
1048488319 8:134868902-134868924 AAGGTGAACTAACCTGTTCCAGG + Intergenic
1050478740 9:6067779-6067801 CAGGTTGGGGAACCTGTTCCTGG + Intergenic
1060418645 9:123451437-123451459 TAGGAGAGCACATCTGTTCCCGG - Intronic
1060542155 9:124438337-124438359 CAGGTCAGCCAAGCTGTTCCGGG + Intergenic
1187310109 X:18133674-18133696 GAGGTTAGCAAACTTGTCCGTGG + Intergenic
1192450963 X:71244606-71244628 AAGGTCATCAAAGCTGTTCCTGG - Intronic
1193272687 X:79547253-79547275 TAAGGTAGAAAACCTGTTCTGGG - Intergenic
1198995118 X:142566123-142566145 TAGGTAGGCATTCCTGTTCCTGG + Intergenic