ID: 981932610

View in Genome Browser
Species Human (GRCh38)
Location 4:150207363-150207385
Sequence CCCAGACATGTATACAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981932610_981932614 0 Left 981932610 4:150207363-150207385 CCCTCTTTGTATACATGTCTGGG 0: 1
1: 0
2: 0
3: 13
4: 173
Right 981932614 4:150207386-150207408 AATTATTTTAATATTTTGGTAGG 0: 1
1: 1
2: 13
3: 179
4: 1459
981932610_981932615 1 Left 981932610 4:150207363-150207385 CCCTCTTTGTATACATGTCTGGG 0: 1
1: 0
2: 0
3: 13
4: 173
Right 981932615 4:150207387-150207409 ATTATTTTAATATTTTGGTAGGG 0: 1
1: 3
2: 9
3: 122
4: 1356
981932610_981932617 30 Left 981932610 4:150207363-150207385 CCCTCTTTGTATACATGTCTGGG 0: 1
1: 0
2: 0
3: 13
4: 173
Right 981932617 4:150207416-150207438 AAAGAACTGAAAATGAAAATAGG 0: 1
1: 3
2: 14
3: 176
4: 1643
981932610_981932613 -4 Left 981932610 4:150207363-150207385 CCCTCTTTGTATACATGTCTGGG 0: 1
1: 0
2: 0
3: 13
4: 173
Right 981932613 4:150207382-150207404 TGGGAATTATTTTAATATTTTGG 0: 1
1: 0
2: 6
3: 93
4: 861
981932610_981932616 2 Left 981932610 4:150207363-150207385 CCCTCTTTGTATACATGTCTGGG 0: 1
1: 0
2: 0
3: 13
4: 173
Right 981932616 4:150207388-150207410 TTATTTTAATATTTTGGTAGGGG 0: 1
1: 0
2: 8
3: 163
4: 1499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981932610 Original CRISPR CCCAGACATGTATACAAAGA GGG (reversed) Intronic
902047540 1:13536976-13536998 GCAAGACATACATACAAAGAGGG + Intergenic
904101483 1:28032691-28032713 CCCAGAGCTGTATACAAATGGGG - Intronic
908341291 1:63182385-63182407 CCCACATATGTATACATATATGG - Intergenic
911814833 1:102334346-102334368 CACAGACATGTCTGCAATGAAGG + Intergenic
911998518 1:104798923-104798945 CACAGACATGTGTGCACAGAGGG + Intergenic
917206681 1:172581159-172581181 CAGAGACATGAATACAAACAGGG - Intronic
919177037 1:194032315-194032337 CACAGACATTTCTCCAAAGAAGG + Intergenic
920685553 1:208106448-208106470 CTAAGACAAGTATTCAAAGAGGG + Intronic
922395419 1:225195456-225195478 ACTACACATGGATACAAAGATGG + Intronic
924698610 1:246427091-246427113 TCCAGGTATGTAAACAAAGAAGG + Intronic
1063682038 10:8197983-8198005 ACCAGAGATGTATAGAAAAATGG + Intergenic
1063914974 10:10872194-10872216 CCCAGACTTGAAAACAAAGCCGG - Intergenic
1068712388 10:60149142-60149164 CCCAGAGATGTGTACACACAAGG + Intronic
1070402214 10:76063108-76063130 TACAGGCATGTATACAAAGTTGG + Intronic
1070712458 10:78692639-78692661 CACAGACATGGAGAGAAAGAAGG + Intergenic
1071309752 10:84331298-84331320 GGCAGCCATGTATTCAAAGAGGG - Intronic
1071820929 10:89279925-89279947 CCCACACAATTGTACAAAGACGG + Intronic
1075321926 10:121498326-121498348 CCTAGCCATGAACACAAAGAAGG - Intronic
1079012338 11:16839486-16839508 CACAGACATATATACATAGTTGG + Intronic
1081585208 11:44379592-44379614 CACATACCTGTATACACAGACGG + Intergenic
1082185701 11:49178003-49178025 GCCAGGCATGTACACATAGAGGG + Intronic
1085871054 11:80349624-80349646 CACAGACATATACACAGAGAGGG + Intergenic
1086941119 11:92799509-92799531 TCCACAGATGTAGACAAAGAAGG - Exonic
1087832967 11:102839573-102839595 CACATACACGTATACAAACACGG - Intronic
1091079294 11:132651550-132651572 CCTAGTCATGTTTACAAATAAGG - Intronic
1092119200 12:6032018-6032040 CCCAGAAATGGAACCAAAGATGG + Intronic
1092587458 12:9913923-9913945 CACATATAGGTATACAAAGACGG + Intronic
1093844388 12:23950868-23950890 CACAGACATGCATGCAGAGATGG + Intronic
1097376585 12:58850555-58850577 CCCAGACATTTCTAAAAATATGG + Intergenic
1102769389 12:115460854-115460876 TCCAGATATATATACAAAGATGG - Intergenic
1102837631 12:116080216-116080238 CCCTGCCAAGTATATAAAGAAGG - Intronic
1103206354 12:119132121-119132143 CACAGACATCTCTACCAAGAAGG - Intronic
1104732879 12:131118263-131118285 CTCATACATGTATACAGAGGGGG - Intronic
1106396184 13:29383085-29383107 CACAGACATGTATTTAATGATGG + Intronic
1108246576 13:48521246-48521268 GCCAGCATTGTATACAAAGATGG - Intronic
1110694927 13:78477030-78477052 CACATACATGTATTCACAGAAGG - Intergenic
1112066108 13:95794905-95794927 CTCAGACATGTCTACAAATATGG + Exonic
1112225737 13:97538154-97538176 ACCAGACATGTAGACACAGGAGG + Intergenic
1113566795 13:111324209-111324231 CACAGACAGGTTTCCAAAGATGG - Intronic
1114005672 14:18310815-18310837 ACCAGACATGCAGACAAATAAGG + Intergenic
1116270779 14:42762631-42762653 AGTAGACATGTATTCAAAGAAGG - Intergenic
1119540578 14:75435525-75435547 CCCAGAAAGGGAAACAAAGAAGG + Intronic
1121164736 14:91781922-91781944 CCCAGGCATGCAGAGAAAGATGG - Exonic
1124875420 15:33587714-33587736 CCCAAAAATCTATCCAAAGATGG - Intronic
1126575268 15:50190382-50190404 CCCAGAAATATTTACCAAGAAGG - Intronic
1127545418 15:59990158-59990180 CTCAGAAATGTATACAGAAAAGG + Intergenic
1128471186 15:67954905-67954927 CCCAGGCATCTGTGCAAAGATGG - Intergenic
1131456906 15:92588682-92588704 CCCAGTCATCTTGACAAAGAAGG + Intergenic
1131535240 15:93232034-93232056 CCCTGCCATCTATACCAAGAAGG - Intergenic
1133330726 16:4971744-4971766 CCCAGGGATATATAGAAAGATGG + Intronic
1133684664 16:8154764-8154786 CACAGACATGCACACAAGGAAGG + Intergenic
1133887462 16:9843943-9843965 CAGAGCCATGTATACTAAGAAGG - Intronic
1135903525 16:26489099-26489121 GCCAGAGATGGATACAGAGAAGG - Intergenic
1138777584 16:59742752-59742774 CCAAGACATGTATATAGAAAAGG + Intronic
1138887563 16:61097926-61097948 CCCATAAATGTATACAATTATGG - Intergenic
1138978852 16:62242064-62242086 ACCATATATGTATAAAAAGATGG + Intergenic
1141172868 16:81702146-81702168 CTCACACATGTGTACACAGAAGG + Intronic
1141308035 16:82885129-82885151 GCAAGAGATGGATACAAAGATGG + Intronic
1145931777 17:28691165-28691187 ACCAAACAAGTACACAAAGAAGG + Intronic
1146183307 17:30710196-30710218 CCCAGACACCTACACAAACAGGG - Intergenic
1148607117 17:48938560-48938582 CCCATATATGTTTACAAAGTTGG + Intronic
1149025755 17:52026015-52026037 CACATACATGTACACACAGAAGG + Intronic
1150870260 17:68901323-68901345 AACAGACATTTCTACAAAGAAGG + Intronic
1152798348 17:82319534-82319556 TCCACACATGTATGCAGAGACGG + Intergenic
1155631564 18:27900068-27900090 CCCAGTGATGTTTACAAACACGG + Intergenic
1156123073 18:33868365-33868387 CACAGACATATATAGAAAAATGG + Intronic
1156578691 18:38350108-38350130 CCCAGACACATGTATAAAGATGG - Intergenic
1157193006 18:45597014-45597036 CTCAGACAAGTCTCCAAAGAAGG + Intronic
1158112615 18:53957866-53957888 CCCAGAGATATATACACACAGGG + Intergenic
1158155747 18:54423642-54423664 CACAGACATGCACACAAAGAGGG + Intergenic
1159800475 18:72893276-72893298 TAAAGACATGTATAAAAAGATGG + Intergenic
1161175714 19:2841295-2841317 CCGAGACAAGTATCCAATGAGGG + Intergenic
1161507908 19:4653966-4653988 CACAGACATGCATGCAAGGAAGG + Exonic
1162689310 19:12415678-12415700 CCAAAACAGGTATAAAAAGAGGG + Intronic
1162975482 19:14205558-14205580 CCCAGACACCTACACAAACAGGG + Intronic
1165508663 19:36252647-36252669 ACCAGACATGTGTGCAAAGCAGG + Intergenic
1165631986 19:37309113-37309135 GCCAGACATGTGTGCAAAGCAGG - Intergenic
1165783382 19:38446689-38446711 CCCAGACTTGTCTACTATGAGGG + Exonic
925555189 2:5122978-5123000 CACATACAAGTATACACAGAAGG + Intergenic
926179118 2:10624766-10624788 CCTTGACATTTATACAAACAAGG + Intronic
931099784 2:58984167-58984189 CCCTGAAATGTATACAATGTGGG + Intergenic
931295990 2:60926481-60926503 CCCAGAGGAGTATGCAAAGAGGG - Exonic
931686533 2:64798859-64798881 TCCATAAATGTATACAGAGAAGG + Intergenic
932283159 2:70512204-70512226 CCCAGACATGAATCCAGAGAGGG - Intronic
937043711 2:118839607-118839629 CCCAGACCTGAATACACAGGTGG + Intergenic
938530853 2:132184306-132184328 ACCAGACATGCAGACAAATAAGG - Intronic
938811949 2:134861947-134861969 CCTAGACATGGACACAAAGAAGG - Exonic
939303868 2:140384147-140384169 CCAAGACATGTCTACAGAGTTGG + Intronic
941774970 2:169383271-169383293 AACAGACATTTATCCAAAGAAGG + Intergenic
941803341 2:169685909-169685931 CCCATACATCTATACTAAGTGGG - Intronic
945573257 2:211497803-211497825 CCCAGACATTTATACAGTGTGGG - Intronic
1174034426 20:47659512-47659534 CCCAAAGAACTATACAAAGAAGG + Intronic
1174567272 20:51474278-51474300 GCCAGGAATGTATACCAAGATGG + Intronic
1176765602 21:13015105-13015127 ACCAGACATGCAGACAAATAAGG + Intergenic
1179118868 21:38523868-38523890 GCCAGACATGTATTCTGAGATGG - Intronic
1180430182 22:15241621-15241643 ACCAGACATGCAGACAAATAAGG + Intergenic
1180512787 22:16109857-16109879 ACCAGACATGCAGACAAATAAGG + Intergenic
952592832 3:34978152-34978174 ACCAGACAAGGATACAATGAAGG - Intergenic
955533410 3:59898410-59898432 CGCACACATATATACAAATATGG - Intronic
955889120 3:63631882-63631904 GACAGACATGTAAACAAACATGG - Intergenic
957766220 3:84628511-84628533 CCCAGACATGTACACGCTGATGG - Intergenic
959438929 3:106352505-106352527 ACTAGACATGGACACAAAGAAGG - Intergenic
960346960 3:116544908-116544930 ACCACACATGGATACAAAGAAGG + Intronic
961308911 3:125980505-125980527 ACCAGACATGTAGGCACAGAGGG - Intronic
963415678 3:144992930-144992952 ACCAGACATTTATAAAAAGAAGG - Intergenic
965101628 3:164306249-164306271 ACTAGACAAATATACAAAGAAGG + Intergenic
965180561 3:165397464-165397486 AGAACACATGTATACAAAGAAGG + Intergenic
965907904 3:173732962-173732984 CACAGAAATATATACAAATATGG + Intronic
966558582 3:181292462-181292484 GCCAGACAGGAATACTAAGATGG - Intergenic
966981040 3:185135754-185135776 CCCATAAATATATACAAATATGG + Intronic
967081606 3:186054787-186054809 CCCTCACAGGTATACAAGGAGGG + Intronic
967477980 3:189942946-189942968 CCTAGAAATGAATACAAGGAGGG - Intergenic
968499043 4:937000-937022 CCCTGACATGCATACAATTAAGG + Intronic
969046532 4:4340515-4340537 ACCAGGCTTTTATACAAAGAAGG - Intergenic
970878629 4:20902166-20902188 GCCAGACTTGTATCCAAAAAAGG - Intronic
974601702 4:64091077-64091099 CACAAACATGTAAAAAAAGAAGG - Intergenic
975667872 4:76751662-76751684 CTTAGACATTTATCCAAAGATGG + Intronic
975971457 4:80043187-80043209 CCCAAAAATTTATACAAATATGG + Intronic
976081812 4:81363605-81363627 ATCAGAAATGCATACAAAGAGGG + Intergenic
977367053 4:96083271-96083293 CCAAGAAATATGTACAAAGAAGG + Intergenic
979275990 4:118814868-118814890 CCCATACATGCATATAAGGAAGG + Intronic
981932610 4:150207363-150207385 CCCAGACATGTATACAAAGAGGG - Intronic
983459107 4:168004826-168004848 ACCAGAGTTGTATGCAAAGAAGG - Intergenic
986904216 5:12473778-12473800 CGAACACATGGATACAAAGAGGG + Intergenic
987510507 5:18830727-18830749 AGCATACATGTATACAATGATGG + Intergenic
987801794 5:22707290-22707312 CCCAGAAAAATTTACAAAGACGG - Intronic
987967598 5:24895923-24895945 CCTAGAAATGTCAACAAAGACGG - Intergenic
988352195 5:30123718-30123740 CCCAAACATTTTTTCAAAGAGGG + Intergenic
989998894 5:50869432-50869454 CCCAGATAAGCATACAAAAATGG - Intergenic
991474244 5:67003258-67003280 CCCACAGAGGTAGACAAAGAAGG - Intronic
992167065 5:74064048-74064070 CCCACACATTTATACAATGCTGG + Intergenic
993284353 5:85971986-85972008 CCTATACATGTATATAAAAATGG + Intergenic
993459204 5:88162221-88162243 CACACACATGGATATAAAGAAGG - Intergenic
995857399 5:116607778-116607800 CCAGGACAAGTATCCAAAGAAGG + Intergenic
996999783 5:129746058-129746080 CCCACACATGGATATAAAGATGG + Intergenic
999399677 5:151254973-151254995 CCCATAAATGTATACAACTATGG + Intronic
999976399 5:156916084-156916106 CCCATACCTGTATTGAAAGAGGG + Intergenic
999990954 5:157049325-157049347 CTTAGAAATGTATTCAAAGATGG + Intronic
1007888700 6:45263433-45263455 GGCAGACATGGATATAAAGATGG + Intronic
1010079874 6:71848330-71848352 CCCAGACAGGGATTCAGAGAAGG - Intergenic
1010452118 6:76014853-76014875 CCCAGATAGGTTCACAAAGAGGG - Intronic
1014473023 6:121839132-121839154 CCCAGCCAAGTACACAAACAAGG + Intergenic
1015806751 6:137117775-137117797 TTCAGAAATTTATACAAAGAGGG + Intergenic
1017457175 6:154612066-154612088 CCCAGAAATGTCTACAAATAAGG + Intergenic
1019158401 6:170053658-170053680 TGCAGGCATGGATACAAAGAGGG + Intergenic
1019383212 7:739104-739126 CCCAAACAGGTATACAGTGATGG - Intronic
1019383227 7:739173-739195 CCCAAACAGGTATACAGTGATGG - Intronic
1023345007 7:39262550-39262572 CCTAGTCATTTATAAAAAGAAGG - Intronic
1023599889 7:41871848-41871870 TAAAGAGATGTATACAAAGAAGG + Intergenic
1023600081 7:41874049-41874071 CCCAGCAATGTGTACCAAGAGGG - Intergenic
1023847684 7:44131906-44131928 CCCAGACAGGCACACAGAGAGGG + Intergenic
1027861177 7:83583961-83583983 CACAGCTATGTGTACAAAGAGGG + Intronic
1031192303 7:118568834-118568856 CACATATATGTATACAAACATGG + Intergenic
1031756113 7:125645079-125645101 CCAAGAAATGGATACAAAAATGG - Intergenic
1033818979 7:145110300-145110322 ACAACACATGAATACAAAGAAGG - Intergenic
1035366136 7:158350114-158350136 CCAAGACATGGGTAAAAAGAAGG + Intronic
1038082360 8:24153348-24153370 CACACACATGTTTAAAAAGAGGG + Intergenic
1039012947 8:33115720-33115742 CACTGACATATATACAAACATGG + Intergenic
1039800884 8:40953462-40953484 CCCAGCCATGTCTTCAAGGAAGG + Intergenic
1040998518 8:53426330-53426352 CTCACACATGCATACAATGATGG + Intergenic
1041437325 8:57856813-57856835 CTCAGACAGGCATACACAGAAGG + Intergenic
1042303201 8:67308089-67308111 ACCAGACATGTAAGTAAAGATGG + Intronic
1044747369 8:95383743-95383765 GACAGACATGTATACAAAAAAGG - Intergenic
1045549848 8:103161875-103161897 TCCAGAATTGTATAAAAAGATGG - Intronic
1046786229 8:118269846-118269868 TCCAGATCTGTACACAAAGATGG - Intronic
1047646787 8:126878245-126878267 CCGAGACATGTCTCAAAAGAGGG + Intergenic
1049699155 8:144000053-144000075 CCAAGACTTGCATAAAAAGAAGG + Intronic
1050164473 9:2749485-2749507 CATAGACATGTATACATACATGG - Intronic
1051698932 9:19798494-19798516 CCAAGTCATTTTTACAAAGAGGG + Intergenic
1053709459 9:40790822-40790844 ACCAGACATGCAGACAAATAAGG - Intergenic
1054419367 9:64911624-64911646 ACCAGACATGCAGACAAATAAGG - Intergenic
1054988735 9:71296424-71296446 CCTAGACTAGAATACAAAGAAGG + Intronic
1057134346 9:92676601-92676623 CCCACACAGGAATACAAAGATGG + Intergenic
1061696346 9:132377048-132377070 CCCACAAATGGCTACAAAGAAGG + Intronic
1186356081 X:8792007-8792029 CTCAGACATGTAGCCAAAAATGG + Intronic
1187299953 X:18038603-18038625 ACCAGAAATGGATACAAAGTTGG - Intergenic
1188164968 X:26850987-26851009 CCCAGACAGGTCTACAAAGGTGG - Intergenic
1188288660 X:28361797-28361819 CTTAGACATTTATCCAAAGAAGG + Intergenic
1190470597 X:50775421-50775443 CCTAGGCATGAATACAAAGAGGG + Intronic
1190910955 X:54772299-54772321 AACACACATGTACACAAAGAAGG + Intronic
1192693604 X:73391236-73391258 CCCACACATGTATACCAGCAAGG - Intergenic
1194621593 X:96179446-96179468 CCCAGAAAAGTATAGAAAGTAGG + Intergenic
1195239322 X:102935451-102935473 CACAGACATCCATATAAAGAAGG - Intergenic
1195516079 X:105777643-105777665 CCACGAAATGTATACAAGGAAGG + Intergenic
1197173494 X:123460335-123460357 ACCAGACCTGAATACAAAGTGGG - Intronic
1197450622 X:126610765-126610787 CCCTGAAATGTCTAGAAAGAAGG + Intergenic
1201910816 Y:19132058-19132080 CCCAAACATGTATCCAGAGTTGG - Intergenic