ID: 981932654

View in Genome Browser
Species Human (GRCh38)
Location 4:150207876-150207898
Sequence TGGTATAGAGACCACTGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981932654 Original CRISPR TGGTATAGAGACCACTGTAG TGG Intronic
902312639 1:15593385-15593407 AGGTATAGTGACCACTGCAATGG + Intergenic
905892000 1:41523575-41523597 TGGTATAGAGAGAACGGAAGGGG + Intronic
906594288 1:47060712-47060734 TGGGATAGAGAGTCCTGTAGAGG - Intergenic
907893091 1:58654625-58654647 TGTTATATAGAACACTGTAGGGG - Intergenic
910310877 1:85823070-85823092 AGGTATAGCGACCACTGCAATGG - Intronic
910985311 1:92999241-92999263 TGGGAGGGAGAACACTGTAGTGG + Intergenic
911402418 1:97393005-97393027 TGGTATGGAGAACATTTTAGTGG - Intronic
911808576 1:102243813-102243835 TAGTACAGAGACCAGTGAAGAGG + Intergenic
912032176 1:105262462-105262484 TGGTAAAAATACCACTGTTGTGG + Intergenic
918597471 1:186308277-186308299 TGGAGTAGAGACCTCTGAAGTGG - Exonic
920960814 1:210662586-210662608 GGGTATAGCAACCACTGCAGTGG + Intronic
921492862 1:215800099-215800121 TGGTATAAAGACAACTCTAAAGG + Intronic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
923649849 1:235864205-235864227 AGGTATAGAGACCTCTGCAGTGG - Intronic
924498896 1:244617386-244617408 TGCTATAAAGAGCACTGCAGGGG + Intronic
1066003635 10:31127744-31127766 TGGTATAGACAGAACTGTTGGGG - Intergenic
1070027412 10:72645379-72645401 AGGTATAGGGACCACTGCAATGG + Intergenic
1076353231 10:129832811-129832833 TGGTATAGAGCCAACTGGGGTGG + Intergenic
1080047389 11:27823063-27823085 TGGTCTAGAGTCCACTGTTTTGG - Intergenic
1082939523 11:58689460-58689482 TGGTATAGGGACCACTGCAATGG + Intronic
1092559605 12:9597668-9597690 AGGTAAAGAGACCAATTTAGTGG - Intronic
1095421984 12:42033624-42033646 TGGTTTAGAGAACACTGGATAGG - Intergenic
1095437840 12:42211050-42211072 TGGTATAGAAGCCACCATAGTGG + Intronic
1099950635 12:89298570-89298592 TGTTATAGTTATCACTGTAGAGG - Intergenic
1100950429 12:99842734-99842756 AGGTATAGGGACCACTGCAATGG - Intronic
1108172077 13:47751888-47751910 TGGTAGGGAAACCACTGTGGGGG - Intergenic
1110678475 13:78278901-78278923 TGGTATAGAAATGACTATAGGGG - Intergenic
1111647268 13:91046748-91046770 AGGTATAGAGACTACTGCAATGG - Intergenic
1114536553 14:23426672-23426694 TGGTTTGGAAACCACTGTGGTGG + Intronic
1115856660 14:37636966-37636988 TGGAATAGAGAACACAGAAGTGG + Intronic
1116741936 14:48766684-48766706 TGCTATAGAGAACAATGTGGAGG + Intergenic
1117969488 14:61237930-61237952 AGGTATAGAAACAACTGTATTGG + Intronic
1118632784 14:67721489-67721511 TGGTAAAGAGCCCAAGGTAGGGG - Intronic
1119121957 14:72088018-72088040 TCAGATAGAGACCACTGTGGAGG + Intronic
1119147882 14:72333026-72333048 TGGTATGGAGAACACAGCAGTGG + Intronic
1124098965 15:26675579-26675601 AGGTATAGGAACCACTGCAGTGG + Intronic
1124991439 15:34677887-34677909 TGATATAGAGACAACTTTTGAGG + Intergenic
1128741908 15:70089622-70089644 TGCTATAGAGACCTCAGCAGAGG + Intronic
1129028555 15:72602549-72602571 TGGTGTGGAAACCACTGAAGAGG - Exonic
1133535345 16:6697205-6697227 TGGTATAGTGGTCACTGTAGTGG + Intronic
1138620104 16:58204342-58204364 AGGTATAGGGACCACTGCAAGGG - Intergenic
1140029747 16:71326115-71326137 TGGTAAAGAGATCACAGTAATGG - Intergenic
1141853764 16:86666889-86666911 TGGCCTAAAGACCACTGTTGGGG - Intergenic
1142665893 17:1463639-1463661 TGGGAAAGAAGCCACTGTAGAGG + Intergenic
1144566584 17:16364423-16364445 GGGTATAGGAACCACTGTAATGG + Intergenic
1147231783 17:39024826-39024848 TGGAATAGAGACCACTGGGCTGG - Intergenic
1149702655 17:58668285-58668307 AGGTATAGAGACCGCTGCAATGG - Intronic
1155310160 18:24515420-24515442 AGGTGTAGAGACCATTGCAGTGG - Intergenic
1158558595 18:58495130-58495152 TGGTTGAGAGACCTCTTTAGAGG - Intronic
1158933257 18:62341595-62341617 TTGGATACAGACCACTGCAGTGG + Intronic
1165722109 19:38086751-38086773 AGGCATAGGGACCACTGCAGCGG + Intronic
927041606 2:19236272-19236294 GGGTGGAGAGACCACTTTAGTGG - Intergenic
928012233 2:27620510-27620532 AGGTACAGGGACCACTGCAGTGG + Intronic
928177098 2:29041829-29041851 TGGTAGAGAGACCAATGAAGAGG - Intronic
928727631 2:34193090-34193112 TGGTATATAGATCAATATAGTGG + Intergenic
929204887 2:39279592-39279614 GGGTTTAGTGACCACTTTAGAGG - Intronic
931058850 2:58503821-58503843 AGGTATAGAGACCACTGTAATGG + Intergenic
936797741 2:116227054-116227076 TGGCATATAGACCAATATAGAGG - Intergenic
943685084 2:190809953-190809975 TGGCAGAGAGACCAAGGTAGAGG - Intergenic
946682546 2:222232375-222232397 AGGTATAGGGATCACTGTAATGG - Intronic
946689114 2:222297755-222297777 TGGGACAGAGACCACAGCAGCGG + Intronic
1168792984 20:592338-592360 TGGTTTAGGGAGCACTGAAGAGG - Intergenic
1169761834 20:9103964-9103986 TGGAACAGAGACCAATTTAGAGG - Intronic
1172573526 20:35988643-35988665 AGGTATAGGGACCACTGCAATGG + Intronic
1172937650 20:38631783-38631805 TGGAATAGAGGCTACTGCAGGGG - Intronic
1173369341 20:42420819-42420841 TGTTGCAGAGAACACTGTAGTGG + Intronic
1173407582 20:42779905-42779927 TGGGATTCAGACCACTGAAGTGG - Intronic
1183775527 22:39961951-39961973 TGCTAAAGAGACCACTTTAAAGG - Intronic
1183941938 22:41301013-41301035 GGGTGTAGGGACCACTGCAGTGG - Intergenic
1185405309 22:50644821-50644843 AGGTATAGAGACCACTGGAAGGG - Intergenic
1203310269 22_KI270736v1_random:137827-137849 TGGAATAGAGATGAATGTAGTGG + Intergenic
950951471 3:17004369-17004391 TGGAATACAGAATACTGTAGAGG + Intronic
955302000 3:57789240-57789262 AGGTATAGAAACCACTGCAGTGG + Intronic
957657823 3:83104230-83104252 GGGTATAGAGATCACTATAATGG - Intergenic
963469461 3:145721684-145721706 AGGTATAGGGACTACTGGAGTGG - Intergenic
965464688 3:169013410-169013432 GGGTAGAGAGACCACTGAGGAGG - Intergenic
970855572 4:20646896-20646918 AGGTATAGGGACCACTGCAATGG - Intergenic
970859240 4:20682908-20682930 TGGGATACAGACCACTGAGGAGG + Intergenic
972875588 4:43355052-43355074 TGGTGGAGAGACCACTGGACTGG + Intergenic
977165006 4:93683936-93683958 AGGTATAGGGACCACTGCAATGG + Intronic
979300468 4:119080778-119080800 AGGTATAGGGACCATTGCAGTGG + Intergenic
981932654 4:150207876-150207898 TGGTATAGAGACCACTGTAGTGG + Intronic
984808331 4:183771909-183771931 TGGTATTGTGGCCACTGTATAGG + Intergenic
988131812 5:27116278-27116300 AAGTATAGAGACCACTGCAATGG + Intronic
989033202 5:37141165-37141187 AGGCATAGAGACCACTGAGGAGG - Intronic
989771740 5:45154027-45154049 TGTTATAGAGATTACGGTAGTGG - Intergenic
990276417 5:54201725-54201747 AGGTATAGGGACCACTGCATTGG - Intronic
992822838 5:80515416-80515438 TGATATAGAGAACACTGGACTGG - Intronic
993245717 5:85450494-85450516 TGCTGCAGAGATCACTGTAGGGG - Intergenic
994121137 5:96114258-96114280 TGGTCCACAGACCACTCTAGGGG - Intergenic
999642185 5:153682756-153682778 AGGTATAGAGACCCCTGCAATGG - Intronic
1004080518 6:12387791-12387813 TGGTAAAGAGTGCACTGTATAGG + Intergenic
1004733867 6:18385660-18385682 TGGTATAGTGACCATTTTGGTGG - Intergenic
1007044606 6:38759935-38759957 AGGTATAGGGACCACTGCAATGG - Intronic
1010004769 6:70983764-70983786 AGGTATAGGGACCACTGCAATGG + Intergenic
1010508784 6:76691842-76691864 AGGTATAAAGACCACTGTAGTGG + Intergenic
1011013406 6:82727283-82727305 TGGGATAGGGACCACTGCTGGGG + Intergenic
1012102235 6:95104688-95104710 TGGTACAGAGACCACCTTGGAGG + Intergenic
1012497063 6:99844966-99844988 AGGTATAGGGACCACTGCAATGG - Intergenic
1013146009 6:107392900-107392922 TGGTATAAAGGACACTGTATTGG - Intronic
1013862822 6:114657512-114657534 TGGTATAAAGAGCAATGTGGAGG + Intergenic
1013962039 6:115912168-115912190 AGGTATAGAGACCACTGCAAAGG + Intergenic
1014552983 6:122810378-122810400 AGGTATAGGGACCACTGCAATGG + Intergenic
1015871410 6:137779961-137779983 AGGTATAGAGACCACTGTACTGG - Intergenic
1017144021 6:151217549-151217571 TTGTATAGGGACCACTGCAATGG - Intergenic
1022028433 7:26469554-26469576 TGGTACTGACACCACTTTAGTGG + Intergenic
1023584570 7:41715743-41715765 GGGGATAGAGACCACTGCAAAGG - Intergenic
1023833967 7:44057773-44057795 TGGTACACAGAGCCCTGTAGGGG - Exonic
1026370518 7:69693954-69693976 TAGTGTAAAGACCACAGTAGTGG - Intronic
1027644398 7:80779048-80779070 TGTTATAGAGAGCACTGTGCTGG - Intronic
1028434303 7:90783849-90783871 TGCTATAGAGAATACTGTGGAGG + Intronic
1031929037 7:127665642-127665664 AGGTATAGGGACCACTGCAGTGG + Intronic
1032224995 7:130024137-130024159 TGGTATCGTAACCAATGTAGTGG + Intronic
1032783513 7:135183129-135183151 AGGTATAGGGACCACTGCAATGG - Intergenic
1037089040 8:14890388-14890410 TGATATAGAGACAGCTTTAGTGG + Intronic
1038108299 8:24463354-24463376 AGATATAGAGACCACTGCAATGG + Intronic
1038713729 8:29973003-29973025 AGCTATAGAGACCACTGCAATGG - Intergenic
1042642521 8:70951840-70951862 TGCTATGGAGACCCCTGTAGTGG - Intergenic
1047123016 8:121927239-121927261 TGAATCAGAGACCACTGTAGTGG + Intergenic
1052186494 9:25602820-25602842 TGGTAGAGAGAGTTCTGTAGTGG + Intergenic
1052726561 9:32234940-32234962 GGGTATAGGGACCATTGTAATGG - Intergenic
1055891354 9:81127443-81127465 TGGTATAGAGACAACTTAACTGG + Intergenic
1056018322 9:82415894-82415916 AGGTATAGGAACCACTGTAATGG + Intergenic
1056285445 9:85083141-85083163 TGTGCTAGAGACCACTGTAGGGG + Intergenic
1056568171 9:87793182-87793204 TCTTCTAGAGACCACTCTAGTGG + Intergenic
1057176496 9:93004167-93004189 TGGTCTAGAGAACACTTGAGGGG - Intronic
1059595428 9:115715038-115715060 TGGTAGAGAGAGCACTGGACTGG + Intergenic
1060395358 9:123312756-123312778 AGGAATAGAGACCACTCTGGTGG + Intergenic
1062368252 9:136222414-136222436 TGGCAGAGAGACCACAGGAGTGG + Intronic
1062720763 9:138042724-138042746 TGGTATAGACCCCACTGCTGTGG + Intronic
1187827458 X:23346300-23346322 TGGTATAGGGACTACTGCAGTGG + Intronic
1188813397 X:34681136-34681158 TGCTATTGATACCACTGTTGTGG - Intergenic
1189650236 X:43181014-43181036 AGGTATAGGGACCACTGTAATGG - Intergenic
1189995414 X:46632681-46632703 TGGAATAGGGACCACTGTGATGG - Intronic
1195934592 X:110112824-110112846 TTGCATAGAGCCCACTGTAATGG + Intronic
1196322251 X:114355204-114355226 TGGCCTAGAAACCACTGGAGAGG + Intergenic
1196425440 X:115563844-115563866 TGGTAGATAGACCCCTCTAGTGG + Intronic
1201106726 Y:10768892-10768914 TGGAATAGAGAGAAATGTAGTGG - Intergenic
1201133506 Y:10973092-10973114 TGGAATAGAGAGGAATGTAGTGG - Intergenic