ID: 981933542

View in Genome Browser
Species Human (GRCh38)
Location 4:150215429-150215451
Sequence GAGTTCCCATGACCCCTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 1, 2: 9, 3: 40, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981933539_981933542 11 Left 981933539 4:150215395-150215417 CCTCTGGAACTTGTGAATGACCA 0: 1
1: 0
2: 7
3: 29
4: 245
Right 981933542 4:150215429-150215451 GAGTTCCCATGACCCCTCTTTGG 0: 1
1: 1
2: 9
3: 40
4: 175
981933541_981933542 -9 Left 981933541 4:150215415-150215437 CCAGCTTCAAGTTGGAGTTCCCA 0: 5
1: 47
2: 72
3: 88
4: 183
Right 981933542 4:150215429-150215451 GAGTTCCCATGACCCCTCTTTGG 0: 1
1: 1
2: 9
3: 40
4: 175
981933537_981933542 28 Left 981933537 4:150215378-150215400 CCAGTGGCAAGTCTGGGCCTCTG 0: 1
1: 12
2: 39
3: 89
4: 347
Right 981933542 4:150215429-150215451 GAGTTCCCATGACCCCTCTTTGG 0: 1
1: 1
2: 9
3: 40
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981933542 Original CRISPR GAGTTCCCATGACCCCTCTT TGG Intronic
900486358 1:2924580-2924602 GTGTCCCCACGTCCCCTCTTGGG + Intergenic
902285141 1:15403425-15403447 GGGTTCCCATGACCCTTCTGTGG + Intergenic
903056837 1:20641945-20641967 GAGCTCCCATGACACCTGCTGGG + Intronic
903253185 1:22072016-22072038 GGATTCCCATGGCCCTTCTTAGG + Intronic
903603369 1:24557711-24557733 GGGTTCCCATGACCCCTTCATGG + Intronic
903696402 1:25210625-25210647 GAGTTGCCATGCCCTCTCTCGGG + Intergenic
905107033 1:35569995-35570017 GGCTCCCCATGACCCATCTTCGG - Intergenic
905844729 1:41219352-41219374 GGGTTCCCATGATCCCTTTCAGG - Intronic
907476403 1:54708835-54708857 TCCTTCCCAGGACCCCTCTTGGG + Intronic
907801149 1:57767004-57767026 GAGCTTCCATGACCTCTCTGAGG + Intronic
907965645 1:59325935-59325957 GAGTTTCCATAAAACCTCTTAGG - Intronic
911889137 1:103344824-103344846 GGGTTCCCAATACCCCTCCTTGG + Intergenic
912432071 1:109633183-109633205 GAGTTCCCCTCACCCTTCTAAGG - Intergenic
914440402 1:147700439-147700461 GAGTTCCCACAAACCCTCTGTGG - Intergenic
915006770 1:152645464-152645486 GAGCTCCCAGGACCCCTCTCTGG + Intergenic
915909800 1:159907532-159907554 GGGTTCCCACAACCCCCCTTTGG - Intergenic
916282257 1:163064651-163064673 TAGTTTCTATGACCCATCTTGGG + Intergenic
916293097 1:163187811-163187833 AGGTTCCCAGGACCCCTCTTTGG - Intronic
917260355 1:173160418-173160440 TAGTTTCCATGACCCCACCTTGG + Intergenic
918990871 1:191695715-191695737 AGGATCCCAAGACCCCTCTTTGG - Intergenic
920163295 1:204016546-204016568 GGGTTTCCATGACCCCTTTCTGG - Intergenic
920266929 1:204730967-204730989 GAGTGCCCACCACCCCTCTGTGG + Intergenic
920278413 1:204825575-204825597 GCATTCCCAAGACCCCTCTTAGG + Intergenic
921316957 1:213901021-213901043 GAGTCCCCATGACATTTCTTTGG - Intergenic
921345099 1:214175638-214175660 GAGTTCCAATGACACCTGATTGG + Intergenic
922334219 1:224605952-224605974 TAGTTCCCTTGACCACTCTGTGG + Intronic
923958255 1:239047044-239047066 TAGTTTCTATGACCTCTCTTGGG + Intergenic
924924704 1:248668119-248668141 AAGTTCACATGACTCCTTTTGGG - Intergenic
1063194007 10:3723147-3723169 TAGTGCCCATGACCCACCTTAGG + Intergenic
1064217084 10:13409578-13409600 GAGATCCAAGAACCCCTCTTGGG + Intergenic
1069601143 10:69708872-69708894 GAGTTCCCTTGACCCCCTTGTGG - Intergenic
1069726822 10:70585558-70585580 CAGTTCCCATGCCCATTCTTGGG - Intergenic
1070347044 10:75554538-75554560 GAGTTCCTATCACTACTCTTAGG + Intronic
1070430232 10:76330548-76330570 TAGTTTCGATGACCCCACTTAGG + Intronic
1071709958 10:88040434-88040456 GTCTTCCCATGGCCCCTCTTGGG + Intergenic
1072173555 10:92892114-92892136 AAGTTCCCAAGACCACTCTCAGG + Intronic
1074602791 10:114932199-114932221 GAGTTCCCAAGACCAATCTCAGG - Intergenic
1077532860 11:3105421-3105443 GGCTCCCCATGACCCCTCATGGG - Intronic
1077608309 11:3627137-3627159 CAGTCTCCATGACCCCTCTGTGG + Intergenic
1078379024 11:10822973-10822995 GGGTTCCCACAATCCCTCTTGGG - Intronic
1079676638 11:23235949-23235971 GAATCCCCATGCCCCCTCTTAGG - Intergenic
1079777653 11:24553895-24553917 GAGTTTCCTTGAGCTCTCTTGGG + Intronic
1080065502 11:28007646-28007668 AGGTTCCCAAGACCCCTCTTTGG - Intergenic
1081374279 11:42340219-42340241 GAGTTCCCCGGACCCCTTTGTGG - Intergenic
1084725780 11:70940867-70940889 AAGTGCCCATGACCCCTGTGTGG - Intronic
1091458056 12:622851-622873 GAGTTCACATGGACCCCCTTGGG + Intronic
1092450804 12:8600331-8600353 GGGTTCCCATGACCTTTGTTGGG + Intergenic
1092974218 12:13728576-13728598 GAATTGCCATCTCCCCTCTTTGG - Intronic
1095861579 12:46923762-46923784 GAGTTCCCACTGCCCCTTTTTGG + Intergenic
1099012964 12:77313355-77313377 GAGGTCCCAAGACACCTCTCTGG + Intergenic
1100358944 12:93858676-93858698 TAGTTTCTATGACCCATCTTGGG - Intronic
1102524290 12:113500275-113500297 GAGTTCCAGGGACCCCTCCTGGG + Intergenic
1104833624 12:131772471-131772493 GAGTTCCCTTGACCCTTCTCAGG + Intronic
1105245941 13:18650403-18650425 GTGTTCCCTTGACCCCTTTGCGG + Intergenic
1106207713 13:27615196-27615218 GGGTTCCCATAACCCCTCTTTGG + Intronic
1107624259 13:42267072-42267094 GGGTTCCCAGGCACCCTCTTGGG + Intergenic
1108233035 13:48370487-48370509 GGGTTCCCATGACACCTCTTAGG + Intronic
1110071260 13:71182176-71182198 TAGTTCCCTTGACCCCTGTGTGG + Intergenic
1110582981 13:77153422-77153444 GAGTTCCCTTGACCCCTTTGTGG - Intronic
1111034961 13:82659983-82660005 GAGTTTCCTTGACCCCTTGTGGG - Intergenic
1111427894 13:88112959-88112981 GGGTTCCCATGATCTCTCTGTGG - Intergenic
1118955037 14:70473246-70473268 GGGTTCCCATGACTCCTTTTTGG + Intergenic
1120267127 14:82265457-82265479 GGGTTCCCAAGACCACCCTTAGG + Intergenic
1121737398 14:96228103-96228125 GAGTTCCCTGGACCCCTTCTTGG + Intronic
1122265209 14:100543514-100543536 GAGTGGCCATGACCCCACCTTGG + Intronic
1122348786 14:101076168-101076190 GACTGCCCATGGCCCCTCTGAGG - Intergenic
1122584593 14:102796447-102796469 GGGTTCCCACAAGCCCTCTTTGG - Intronic
1124367325 15:29081321-29081343 GGGTTTCCATAACTCCTCTTTGG - Intronic
1126187189 15:45841707-45841729 GAGTTCCCTTGACCCCTTCACGG - Intergenic
1128066747 15:64769776-64769798 CAGCTCCCATCACCCATCTTGGG + Intronic
1128356755 15:66933416-66933438 GAGTTCCCATGATCACCCTCAGG + Intergenic
1128650919 15:69413099-69413121 TAGTTTCCATGACCCGCCTTGGG + Intergenic
1131982673 15:98010505-98010527 TAGTTGCCATGTCCTCTCTTTGG + Intergenic
1132366539 15:101261863-101261885 GGGTTCCCACAACCCCTCTTTGG + Intergenic
1132374502 15:101319921-101319943 GACTTGCCATGACCCCTCCTTGG - Intronic
1132502674 16:291533-291555 GAGTTCCCTGGACCGCACTTTGG + Intronic
1133630533 16:7616107-7616129 GAGTCCCCAAGACCACTCTCAGG + Intronic
1135212534 16:20535954-20535976 GAGAGCCCATGACTCTTCTTAGG - Intergenic
1135238632 16:20782730-20782752 AGGTTCCCATGACCCTTCCTTGG + Intronic
1135566254 16:23513385-23513407 GAGTTTCCCTGACCCATCTTGGG - Intronic
1139803453 16:69543497-69543519 GAGTTTCCATGTCCTCTCTGGGG - Intergenic
1140482843 16:75271797-75271819 AAGTTCCCATGGACCCTCTGGGG + Intergenic
1142063880 16:88049224-88049246 GGCTTCCCACGACCCGTCTTTGG + Intronic
1147230843 17:39016648-39016670 GGCTTCCCATGACCCCTCTTTGG - Intergenic
1147590141 17:41677547-41677569 GAGTTCCCACAACCCCTCCTTGG - Intergenic
1150637231 17:66922237-66922259 GAGTTCCCAAGACCCCCTCTTGG + Intergenic
1150698166 17:67423832-67423854 GAGTTGCAATGCTCCCTCTTGGG + Intronic
1152051294 17:77980720-77980742 GGATTCCCACCACCCCTCTTTGG + Intergenic
1154442979 18:14409261-14409283 GTGTTCCCTTGACCCCTTTGCGG - Intergenic
1159542527 18:69796190-69796212 GAGTTTCCAGGACCCTTCTTTGG - Intronic
1160127553 18:76190071-76190093 GAGTTCCCTTGACCCCTTCCTGG - Intergenic
1160909527 19:1468283-1468305 GCGTTCCCGGGACCCCTCTGCGG - Exonic
925084490 2:1097267-1097289 GAGCTCCCAGGTCCCCCCTTCGG + Intronic
925706246 2:6686671-6686693 TAGTTCCCTTGACCCCTTTGTGG + Intergenic
927745370 2:25615048-25615070 CGGTTCCCATGACCCTTCCTTGG + Intronic
932750375 2:74367782-74367804 GAGTGCCCATGAGCGCTCCTTGG - Exonic
939584056 2:143985303-143985325 GAGTTCCCTTGACCCTTTTGTGG - Intronic
939588406 2:144033303-144033325 GTATTCCCACAACCCCTCTTTGG + Intronic
939669811 2:144996612-144996634 GAGTTCCCATGATTACTCATTGG - Intergenic
939776075 2:146390245-146390267 TAGTTCCCTTGACCCCTTTGTGG + Intergenic
939843952 2:147221015-147221037 GAGATCCAAGGACCCCTCTTGGG - Intergenic
942560949 2:177217895-177217917 CAGTTCCCATGACACATATTTGG + Intronic
943771513 2:191722537-191722559 GGGTTCCCATGACTCCTGTTTGG + Intergenic
944764046 2:202846487-202846509 GGGTTCCCAAGACTCCTTTTTGG + Intronic
945711377 2:213300433-213300455 GGGTCCCCAAGACCCCTTTTAGG + Intronic
946743745 2:222825978-222826000 GGGTTCCTAAGACCCCTCTTTGG + Intergenic
946811632 2:223531378-223531400 GGGTTCCCATGACTCCTCTTTGG - Intergenic
948663108 2:239518779-239518801 GACATCCCCTGACCCCTTTTTGG - Intergenic
1169232074 20:3896897-3896919 GAGTTTGCATGACCCCTCTTTGG - Intronic
1173061399 20:39665017-39665039 GCATTCCCATAACCCCTTTTTGG - Intergenic
1174323294 20:49759304-49759326 GATTTCCCCTGACCTCTCATTGG - Intergenic
1177295367 21:19166596-19166618 GGGTTCCCATAATCCCTTTTGGG - Intergenic
1179442440 21:41404520-41404542 AAGTTCCCCTAAACCCTCTTAGG - Intronic
1179565339 21:42244237-42244259 GAGCTCCCATGTCCACTCCTAGG - Intronic
1180955484 22:19739503-19739525 GAGTTCCCACGCCCCCACTCTGG + Intergenic
1181696928 22:24597982-24598004 GGGTTCCAAGGCCCCCTCTTTGG + Intronic
1183398503 22:37587243-37587265 GGGATCCCACGACCCCTCTTTGG - Intergenic
1183835684 22:40450942-40450964 CAAGTCCCATGACCCCTCTGAGG + Intronic
1184097965 22:42326746-42326768 GAGCTGCCATGTCCCCTCTTAGG + Intronic
1184161126 22:42697912-42697934 GATTCCCCATGACTCATCTTAGG + Intronic
1184654356 22:45933619-45933641 GAGGTGCCATGATCCCTCTGTGG - Intronic
950204510 3:11068323-11068345 TAGTTCCCTTGACCCCTTTGTGG - Intergenic
951501389 3:23390795-23390817 GAGTTCCCTTGACCCCTTTGTGG - Intronic
954634717 3:52065252-52065274 GAGTTCTCATGGCACCTCGTGGG + Intergenic
955823930 3:62924978-62925000 GAGTACCCAGGTCCCCTTTTGGG + Intergenic
956213508 3:66825528-66825550 GACTTCCCAGGACACCTCTTGGG + Intergenic
956653772 3:71529919-71529941 AAGTTTCCTTGACCCCTCCTTGG - Intronic
958024958 3:88039619-88039641 GAGTTCCCTGAACCCCTCATGGG + Intergenic
959155781 3:102664438-102664460 GAGTTCCCTTGACCCCCTTGTGG - Intergenic
959630165 3:108498765-108498787 GAGACCTCATGATCCCTCTTGGG + Intronic
959946917 3:112134533-112134555 GAGTTCCCTTGACCCCTTCTCGG - Intergenic
961472649 3:127125828-127125850 CAGTTCCAATGTCACCTCTTTGG - Intergenic
961738476 3:129017124-129017146 GACTTCCCCTCACCTCTCTTTGG + Intronic
963445204 3:145396090-145396112 AAGTTCCCTTGTCCCCTCTCAGG - Intergenic
964196117 3:154066788-154066810 CAGTGACCATGACCCTTCTTTGG + Intergenic
964257787 3:154796954-154796976 GGGTTCTCACAACCCCTCTTTGG + Intergenic
965299650 3:166994424-166994446 GAGTTCCCTTGACCCCTTCATGG + Intergenic
970862098 4:20716125-20716147 AGGTTCCCAAGACCACTCTTAGG + Intronic
971315736 4:25566355-25566377 GAGGTCAGATGACCCCTTTTTGG - Intergenic
972714464 4:41632118-41632140 GAGTTCCCAAGCCCTCTTTTGGG + Intronic
977875777 4:102148475-102148497 GAGTTCCCTAGTCCCCTTTTTGG - Intergenic
979657186 4:123209143-123209165 GGGTTCCCATGACCCCTGCTTGG - Intronic
981597587 4:146445266-146445288 GAGTTCCCTTGATCCCTTATGGG + Intronic
981933542 4:150215429-150215451 GAGTTCCCATGACCCCTCTTTGG + Intronic
983867791 4:172789225-172789247 GAGTTCCCATGACCCCCTCTTGG + Intronic
985122920 4:186661737-186661759 CGGTTCCCATGACCTCTCTTTGG - Intronic
985615962 5:922252-922274 AGGTTCCCATAACCCCTCTCAGG + Intergenic
985971703 5:3383427-3383449 GTGTTCCCAGGACCCTTCTTGGG - Intergenic
986001135 5:3631749-3631771 GTGCTCCCATCACCCCTCTGAGG + Intergenic
986707163 5:10461727-10461749 GGGTTCCCACAACCCCTCCTTGG + Intronic
987085718 5:14465768-14465790 GAGTCCCCATGACCACCCTCGGG + Intronic
987303647 5:16618000-16618022 GACCTCCCATGCCCTCTCTTTGG + Intergenic
989275091 5:39579591-39579613 GTTTTCCCATTACCACTCTTCGG - Intergenic
990079776 5:51899095-51899117 GAGTTCCCTTGACCCCTTCGTGG + Intergenic
990463226 5:56048376-56048398 GAGTTCCTTTGACCCCTTCTCGG - Intergenic
990731836 5:58817019-58817041 GAGCTTCCATCAGCCCTCTTGGG - Intronic
992433305 5:76730966-76730988 GAGTTTCCATGCCCTCTCTTGGG + Intronic
994913419 5:105943201-105943223 GGGTTCCCTTGACCCCTTCTCGG + Intergenic
996410333 5:123151788-123151810 CAGTTCCCAGGACACCTCTAGGG - Intronic
996426738 5:123320939-123320961 GAGTTCTCACGACCCCTCTTTGG + Intergenic
998605704 5:143632559-143632581 GGATTCCCATGACACCTCTTTGG + Intergenic
999927196 5:156392362-156392384 AAGTTCCCTTGCCCCCTCTTAGG + Intronic
1000053157 5:157579345-157579367 GGGTTCCCAGGACACCTCTTTGG + Intergenic
1003252015 6:4437104-4437126 GGGTTCCCACGACCCTTCTTTGG - Intergenic
1004429115 6:15528156-15528178 TAGTTGCCATGACTCTTCTTGGG - Intronic
1007821973 6:44567168-44567190 AAGTTCCCATCACTCCTCCTGGG + Intergenic
1008073634 6:47122588-47122610 GAGTGACCATGACCCTTTTTTGG + Intergenic
1009056164 6:58338120-58338142 GAGTTTCCATGACCACTGTCAGG + Intergenic
1009235017 6:61112479-61112501 GAGTTTCCATGACCACTGTCAGG - Intergenic
1009326112 6:62349286-62349308 GATTGCCCAAGACCACTCTTAGG - Intergenic
1013089688 6:106888837-106888859 TAGTTTCCATGACCCCTCCTTGG - Intergenic
1014563820 6:122923902-122923924 GAGTTTTCAAGACCTCTCTTTGG - Intergenic
1014671664 6:124312436-124312458 GGGTTCTCATAACCCCTCTTTGG + Intronic
1014812325 6:125901430-125901452 GAGTTCCCTTGACCCCTTTGTGG + Intronic
1016825613 6:148385943-148385965 GGGTTCCCACGACCCCCTTTTGG - Intronic
1018729377 6:166637286-166637308 GACTTCGCATGGCCCCTCCTTGG - Intronic
1019353263 7:565019-565041 AAGTTCCAATCACCCCTCCTTGG - Intronic
1020862767 7:13515665-13515687 GGGTTTCCATGACCCCTCTTGGG + Intergenic
1021420423 7:20440249-20440271 TAGTTCCCTTGACCCCTTTGTGG - Intergenic
1023405221 7:39826671-39826693 TGGTTCCCATGACCTCTCCTTGG - Intergenic
1023708964 7:42971468-42971490 GAGTTTCCATGACCCCATCTTGG + Intergenic
1024763398 7:52628273-52628295 AAGGTCCCATGTCCCTTCTTGGG + Intergenic
1025978590 7:66389258-66389280 GGGTTCCCATGACCCCCTCTTGG - Intronic
1027265700 7:76494163-76494185 GGGTGCCCCTGACCCCTCGTGGG + Intronic
1027317070 7:76992280-76992302 GGGTGCCCCTGACCCCTCGTGGG + Intergenic
1028734842 7:94197049-94197071 GAGTTCCCATGGTCCTTCCTTGG - Intergenic
1029216571 7:98954660-98954682 GTGTTCCCATGACCTCACATCGG + Intronic
1030493212 7:110265074-110265096 TAGTTTCCATGACCCTCCTTAGG + Intergenic
1031052021 7:116954020-116954042 GAGTTCCCAGGACACCCCCTCGG + Exonic
1031074935 7:117202783-117202805 GGGTTCCCCGGACCTCTCTTGGG + Intronic
1031353768 7:120765848-120765870 GAGTTTCCATGCCCTCTCTGGGG + Intergenic
1031428742 7:121639003-121639025 GAGTTCTCTTTACCCCTCTGAGG + Intergenic
1032070238 7:128800728-128800750 GAGTTCCCATGACCTACCTGTGG - Intronic
1037264759 8:17046113-17046135 GGGTTCACATGATCCCTCTTTGG - Intronic
1037767982 8:21783462-21783484 GAGTTGTCATCACCCTTCTTTGG - Intronic
1038730932 8:30127085-30127107 GAGTTCTCATGACACTTCCTAGG + Intronic
1038810746 8:30839879-30839901 GAGTTCCCATCAGCCCTATGTGG - Intronic
1038848919 8:31255302-31255324 GGGTTCCCATGACCCTTCTTTGG + Intergenic
1039173685 8:34779761-34779783 GAGTTCCCATGACCCCTCTCAGG - Intergenic
1039335932 8:36589414-36589436 GAGTACCCATGACCGCTTATTGG + Intergenic
1042533812 8:69839574-69839596 GGATTCCCACAACCCCTCTTTGG + Intergenic
1045392099 8:101725765-101725787 GAGCTCCCTTGACCCCTCTGTGG - Intronic
1046241574 8:111502538-111502560 GGGTTCACATGACCCAACTTGGG - Intergenic
1048569972 8:135644092-135644114 GAGTTTCCATGTACCCTCTCAGG - Intronic
1049896560 9:115322-115344 AAGTTCCCAAGCCCCATCTTTGG - Intergenic
1050487189 9:6146809-6146831 GAGTTCCCACAACCTCTTTTTGG + Intergenic
1052458182 9:28727960-28727982 GAGATCCCATGGCCCTTCTATGG - Intergenic
1052986858 9:34494152-34494174 GAGTTCCCATGGCTGCTCTCGGG + Intronic
1055799900 9:80023420-80023442 GGGTTCCTGTGACCCTTCTTTGG - Intergenic
1056548949 9:87635728-87635750 GAGGTCTTATGACTCCTCTTTGG + Intronic
1057344199 9:94233645-94233667 AAGTCCCAATGACCCCTATTAGG + Intergenic
1057598394 9:96436345-96436367 GGGTTCCCATGACCACCCTCAGG + Intergenic
1057749051 9:97776024-97776046 TAATTCCCATGACCTTTCTTGGG + Intergenic
1058006696 9:99923753-99923775 GAGTTCCCACGATCCCTTTTTGG + Intronic
1060904111 9:127289268-127289290 GAGTCCCCAAGACCACTCTCAGG + Intronic
1060923375 9:127438289-127438311 GGGTTCCCACGACCCCCCTTTGG + Intronic
1185975467 X:4714581-4714603 GAGTTCCCGTGACCCCCTTGCGG - Intergenic
1187258986 X:17667863-17667885 GACTGTCCATGACCCCGCTTAGG - Intronic
1187413348 X:19070167-19070189 TAGTTCCCTTGACCCCTCTGTGG - Intronic
1188526497 X:31093684-31093706 GAGTTCCCTTGACCCCTTCCTGG + Intergenic
1191767042 X:64709598-64709620 TAGTTCCCTTGACCCCTCCATGG + Intergenic
1193568137 X:83105664-83105686 ATCTTTCCATGACCCCTCTTTGG - Intergenic
1194819795 X:98491388-98491410 GGGTTCCCATGACCCCTTTTGGG - Intergenic
1197254714 X:124250485-124250507 GAGTTCCCATAAATGCTCTTTGG - Intronic
1198093556 X:133355805-133355827 GAGTTCCCATGAGACCTGGTTGG + Intronic
1199682948 X:150240074-150240096 GAGTTCACGGGACCCCTCCTGGG + Intergenic