ID: 981937571

View in Genome Browser
Species Human (GRCh38)
Location 4:150251857-150251879
Sequence GTGGCCACATAAACGCAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981937571 Original CRISPR GTGGCCACATAAACGCAGCC GGG (reversed) Intronic
900083284 1:874946-874968 GAGGCCACACAAACACACCCAGG - Intergenic
901950207 1:12739156-12739178 GTGGCAACATAGATGCAGCTGGG + Intergenic
904036325 1:27561101-27561123 GTGGGCACAGAAACACAGCCCGG + Intronic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
907785622 1:57609593-57609615 TTGGCCACATAAATGGATCCCGG + Intronic
911199838 1:95033251-95033273 GTGGCCACATAACCCTAGCAGGG + Intronic
916416498 1:164597246-164597268 GGGGCCACATAAACCCATCCTGG - Intronic
917551265 1:176032759-176032781 CTGGTCACATAAATGAAGCCTGG + Intronic
917952776 1:180057462-180057484 ATGGCCACATACAAGCAGACAGG - Intronic
918044730 1:180935117-180935139 ATGGCCACAGAAGCCCAGCCCGG + Exonic
920128385 1:203712018-203712040 GTGACAACATCAACACAGCCCGG + Exonic
1062763772 10:46438-46460 GAGGCCACACAAACACACCCAGG + Intergenic
1064953698 10:20882916-20882938 AAGGCCACATAGACGCAGCTAGG - Intronic
1073260560 10:102186928-102186950 GTGTCCACATAAAAACAGTCAGG - Intergenic
1076701877 10:132277484-132277506 GTGGGCACAGAACTGCAGCCGGG - Intronic
1076994545 11:291735-291757 GAGGCCACACAAACGCCGGCTGG + Intronic
1084946014 11:72638931-72638953 GTGGGCAGAGAAATGCAGCCTGG - Intronic
1087383629 11:97440906-97440928 GAGGACACATGAACGCAGGCAGG + Intergenic
1089834019 11:121354051-121354073 GTGGCCACATAACCATGGCCTGG + Intergenic
1090113683 11:123943326-123943348 GGGGCCACAGAAAGGCAGGCTGG + Exonic
1091850660 12:3694210-3694232 ATGGCCAACTAGACGCAGCCAGG - Intronic
1092609281 12:10154381-10154403 ATGGCCAAATAGACGCAGACAGG - Intergenic
1094813615 12:34164147-34164169 GAGGCCACACAAACACACCCAGG + Intergenic
1095103297 12:38204362-38204384 GAGGCCACACAAACACACCCAGG - Intergenic
1100266070 12:92977988-92978010 ATGGCCAACTAGACGCAGCCAGG + Intergenic
1104632797 12:130418619-130418641 CTTGCCACATAAACTCAGCTGGG - Intronic
1105043963 12:132986449-132986471 GCGGCCACAGAGACTCAGCCAGG - Exonic
1109326262 13:60870723-60870745 ATGGCCAACTAAATGCAGCCAGG - Intergenic
1118646702 14:67847234-67847256 ATGGCCAACTAGACGCAGCCAGG - Intronic
1118935507 14:70284287-70284309 GTGTACACATAAATGTAGCCAGG - Intergenic
1122902655 14:104788195-104788217 GAAGCCACCTAGACGCAGCCTGG + Intronic
1122943611 14:104994805-104994827 GTTTCCACATCAACCCAGCCAGG - Exonic
1124549321 15:30663777-30663799 GGGTCCACATATAAGCAGCCAGG - Intronic
1125367454 15:38933016-38933038 ATGGCCAACTAAATGCAGCCAGG - Intergenic
1128117044 15:65114895-65114917 GTGGCCAGATACAGGAAGCCAGG + Intronic
1129718101 15:77863478-77863500 GTTGCCCCATAAGCCCAGCCTGG + Intergenic
1131640181 15:94283764-94283786 ATGGCCAACTAAATGCAGCCAGG - Intronic
1134113895 16:11533874-11533896 GTGGCCATAAAAACGCTGGCTGG + Intergenic
1134746266 16:16591438-16591460 GTGGCCACATAATCCAGGCCGGG + Intergenic
1134999215 16:18762262-18762284 GTGGCCACATAATCCAGGCCGGG - Intergenic
1140841935 16:78847970-78847992 GTGGCCACATAAAGGGAGAGTGG + Intronic
1144127857 17:12219741-12219763 GTGTCCACAGAAACAGAGCCTGG + Intergenic
1146224116 17:31051001-31051023 CGGGCCCCAGAAACGCAGCCAGG + Intergenic
1148174270 17:45550273-45550295 TGGGCCCCAGAAACGCAGCCGGG + Intergenic
1148274992 17:46295174-46295196 TGGGCCCCAGAAACGCAGCCGGG - Exonic
1148297099 17:46512753-46512775 TGGGCCCCAGAAACGCAGCCGGG - Exonic
1148361653 17:47017233-47017255 TGGGCCCCAGAAACGCAGCCGGG - Intronic
1152332412 17:79680808-79680830 GTGGACACATTAAAGCAGACAGG + Intergenic
1152956682 18:46771-46793 GAGGCCACACAAACACACCCAGG + Intergenic
1153330034 18:3864045-3864067 GTGGCCAGATAAAAGCAGGAGGG - Intronic
1157173966 18:45433889-45433911 GTGGCCACATAGACACAGGAAGG + Intronic
1159088324 18:63819092-63819114 ATGGCCAGCTAAACACAGCCAGG - Intergenic
1161003188 19:1921406-1921428 GTGGCCACATGGCGGCAGCCAGG + Intronic
1161887290 19:7006539-7006561 GTGGCCACATGACCTCAACCTGG - Intergenic
1162562393 19:11424164-11424186 GGGGCCAGATAAAGGCACCCGGG + Intronic
1163265576 19:16218660-16218682 ATGGCCAACTAGACGCAGCCAGG - Intronic
926062008 2:9810319-9810341 GTGGTAACATAAACCCACCCAGG - Intergenic
939932876 2:148255680-148255702 ATGGCCACGGAAAGGCAGCCTGG - Intronic
941627052 2:167841536-167841558 GTGGTCACATCATTGCAGCCAGG - Intergenic
941681275 2:168401917-168401939 GTGGCCATCTAGACACAGCCAGG - Intergenic
942848809 2:180458101-180458123 TTGGTCACATGAAAGCAGCCTGG + Intergenic
947890729 2:233616952-233616974 GCGGCCACAGAAAGGCAGCCCGG + Intergenic
1173625223 20:44467455-44467477 GTGACCACAAAAACACAGCCAGG + Intergenic
1175145659 20:56894197-56894219 TAGGCCACATAAACCCAGGCAGG + Intergenic
1185044582 22:48522706-48522728 GTGGCCACAAAACCCCAGGCAGG - Intronic
949681840 3:6522899-6522921 CTGGCCACTTGAACGCATCCAGG + Intergenic
951822302 3:26826799-26826821 ATGGCCAAATAAATGCAGCCAGG + Intergenic
953556843 3:43952773-43952795 ATGGCCACATAAAGCCAACCAGG - Intergenic
955965745 3:64387637-64387659 GTTGCCACAGAAATTCAGCCAGG + Intronic
957685815 3:83502403-83502425 ATGGCCACAGAAAGGCAGCCTGG - Intergenic
959295521 3:104530506-104530528 GTGGCCAACTAGACCCAGCCAGG + Intergenic
960688028 3:120313591-120313613 ATGGCCAACTACACGCAGCCAGG + Intergenic
961705728 3:128783574-128783596 GCGGGCACATAAAAGCAGCCAGG - Intronic
962165302 3:133041195-133041217 GAAGCCACATAAAGCCAGCCAGG - Intronic
969718423 4:8879725-8879747 GTGGACACAGACACGCACCCAGG + Intergenic
969832515 4:9809208-9809230 GTGGACAGATAATCCCAGCCTGG + Intronic
970595574 4:17597190-17597212 GTGGCCACATAACCACAGCTAGG + Intronic
971269799 4:25131510-25131532 GTGGCCACCTAAAAGGATCCAGG + Intronic
972363492 4:38350984-38351006 ATGGCCAAATAGACACAGCCAGG + Intergenic
974723867 4:65774374-65774396 ATGGCCAACTAGACGCAGCCAGG - Intergenic
975344928 4:73282542-73282564 GTGGCCAACTAAATGTAGCCAGG - Intergenic
981937571 4:150251857-150251879 GTGGCCACATAAACGCAGCCGGG - Intronic
982424769 4:155245696-155245718 GTGGCTTCATAAATGCTGCCTGG + Intergenic
983182268 4:164662433-164662455 GTGCCCACATACACGCAAACAGG + Intergenic
984384130 4:179033552-179033574 CTGGCCTCATAAACTGAGCCAGG - Intergenic
987970561 5:24938854-24938876 GTGGCCACGGAGACCCAGCCTGG + Intergenic
990387038 5:55275315-55275337 GTGGCAACTAAAAAGCAGCCAGG + Intronic
993123686 5:83805972-83805994 GTATTCACATAAATGCAGCCAGG - Intergenic
998510194 5:142706739-142706761 GTGGCCACATAAACACAAGTTGG - Intergenic
1000969661 5:167699637-167699659 GTTGCCCCATAAACTCAGCAGGG - Intronic
1002185189 5:177451216-177451238 GTGCCCACAGCAATGCAGCCAGG + Intronic
1003077905 6:2999198-2999220 GTGGCTATAAAAACGCAACCCGG - Intronic
1003085148 6:3054566-3054588 GTGGCTATAAAAACGCAACCCGG + Intergenic
1008753184 6:54761679-54761701 GTGCCCACATAGAGGCAGACTGG + Intergenic
1016098014 6:140061882-140061904 GTACTCACATAAAGGCAGCCTGG + Intergenic
1016577467 6:145584890-145584912 ATGGCCAATTAAATGCAGCCCGG - Intronic
1030910353 7:115240684-115240706 ATGTCCACAAAAACGCATCCTGG + Intergenic
1034997434 7:155587072-155587094 GTGGCCACATCTGTGCAGCCAGG + Intergenic
1035207005 7:157300280-157300302 GTTGCCACATCAGCGCATCCTGG - Intergenic
1039638783 8:39195229-39195251 GTGGCCAATTAGACGCAGCCAGG - Intronic
1048373013 8:133796225-133796247 GTGGACACATACACCCTGCCAGG + Intergenic
1049180959 8:141221973-141221995 ATGGCCAGAGAAAAGCAGCCAGG + Intronic
1051233744 9:14978092-14978114 GTGACCGCAGAAACGCAGCCAGG + Intergenic
1060211463 9:121713054-121713076 GGTGCCACATAAATGCTGCCTGG - Intronic
1060790165 9:126480545-126480567 GTGGCCACAGAAAAGGAACCAGG + Intronic
1062013713 9:134280710-134280732 GTGGCCACCGACACGCAGCACGG + Intergenic
1062522629 9:136964555-136964577 CAGGCCACACAAACACAGCCGGG - Intergenic
1062688136 9:137826912-137826934 GTGACAACTTAAAAGCAGCCTGG - Intronic
1190160827 X:48030318-48030340 GAAGCCACATAAACGCATGCAGG + Intronic
1196462331 X:115943764-115943786 GAGGCCACACTCACGCAGCCTGG - Intergenic
1196635707 X:118000198-118000220 TTGGCCAAACAAATGCAGCCGGG + Intronic
1199196765 X:145041388-145041410 ATGGCCAACTAAATGCAGCCAGG + Intergenic
1200127610 X:153823952-153823974 ATGGCCACATGCACGCATCCTGG - Intronic