ID: 981940908

View in Genome Browser
Species Human (GRCh38)
Location 4:150280720-150280742
Sequence ATATGGGCTCAGATTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981940902_981940908 -5 Left 981940902 4:150280702-150280724 CCATGGTGTCCATTCCTTATATG 0: 1
1: 0
2: 0
3: 16
4: 137
Right 981940908 4:150280720-150280742 ATATGGGCTCAGATTGAGGAAGG 0: 1
1: 0
2: 0
3: 24
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981940908 Original CRISPR ATATGGGCTCAGATTGAGGA AGG Intronic
900179108 1:1303611-1303633 ACATGGGCTGAGAAAGAGGAGGG - Intronic
901839033 1:11942479-11942501 ACATGGGATGAGATTAAGGAGGG + Intronic
901989347 1:13100213-13100235 ATGTGGGTTCAGGTTGAAGAGGG + Intergenic
901992466 1:13126551-13126573 ATGTGGGTTCAGGTTGAAGAGGG - Intergenic
902257149 1:15197282-15197304 ATATGGACTGAGAATGGGGAGGG + Intronic
903841558 1:26245370-26245392 ACATGGGCCCAGATTAAAGAAGG - Intronic
904908665 1:33917436-33917458 GGATGTGCTCAAATTGAGGATGG - Intronic
905908376 1:41636239-41636261 AAATGGGTACAGAATGAGGAAGG + Intronic
906846458 1:49197970-49197992 TTATGAGCTGAGATTGAGAATGG + Intronic
907374260 1:54022572-54022594 AGCTGAGCTCAGATTGAGGCTGG + Intergenic
907651207 1:56296424-56296446 ATTGAGGCTCAGATTGAGGAAGG - Intergenic
909264401 1:73537826-73537848 ATATCAGCACAGATTGGGGATGG + Intergenic
909943398 1:81635955-81635977 ATATGTGCTGAGTGTGAGGACGG - Intronic
911180201 1:94853714-94853736 TCATGGGCTGAGAGTGAGGATGG + Intronic
912621404 1:111162925-111162947 ATATGGGCTCAAAGGAAGGAGGG + Intronic
912663934 1:111562003-111562025 ATTTGGGTTCAGAGTGTGGAGGG - Intronic
912733015 1:112126473-112126495 ATATGGGTTCAAATTGACAAGGG - Intergenic
916733063 1:167583461-167583483 TTATGGACTCAGAATGGGGAGGG - Intergenic
917764833 1:178204315-178204337 ATATGGGTTCAGGTTGACAAGGG + Intronic
918170283 1:181989765-181989787 ATATGGGTGCAGATGGTGGAAGG - Intergenic
918177861 1:182061065-182061087 ATATGGCTTCAGATGGAGGAGGG - Intronic
920044757 1:203126175-203126197 AGATGGGCCCAGCTTGGGGACGG - Intronic
920069277 1:203290685-203290707 ATATGGGCACAGACTCCGGAGGG + Intergenic
920848544 1:209613008-209613030 AAAGGGGCTCAGAGTGAGGAGGG - Intronic
921299046 1:213732805-213732827 CTAGGGGCTGAGATTGGGGAGGG - Intergenic
922770274 1:228178140-228178162 ATGTGGGCTCAGAAAGTGGAAGG - Exonic
923329407 1:232908884-232908906 ACAAGAGCTGAGATTGAGGAAGG - Intergenic
1067218797 10:44326487-44326509 ATCTGGGGCCAGATTGAGGGAGG - Intergenic
1069671920 10:70213525-70213547 ATATTGGCTATGATTGACGAAGG - Exonic
1070526844 10:77302719-77302741 TTATGGGCTCAGAAAGGGGATGG + Intronic
1074618212 10:115092454-115092476 ATATCGTCCCAGATGGAGGAGGG + Intergenic
1074659001 10:115629309-115629331 ATAAATGCTCAGATTGAGTACGG + Intronic
1074738911 10:116465176-116465198 TTATAGGCTCAGAATGAGGGAGG + Intronic
1075583243 10:123638121-123638143 ATGAGGGCTCAGTGTGAGGAAGG - Intergenic
1076246719 10:128952691-128952713 AGATGGGCTGTGATTGCGGAGGG + Intergenic
1078415387 11:11160657-11160679 TTATGGGCTTAGAATGGGGAAGG - Intergenic
1080202444 11:29688485-29688507 ATATGGCCTCAGCTTGTGAAGGG + Intergenic
1083121671 11:60519458-60519480 TTATGAGCTGAGATTGAGTATGG + Intronic
1083410735 11:62490609-62490631 AATGGGGCTCAGATGGAGGAAGG + Intronic
1083455396 11:62775473-62775495 ACAAGGGCTCAGACTGATGAAGG + Intronic
1084868820 11:72081713-72081735 ATCTGGGGACAGATTGAGAAGGG - Intronic
1084951079 11:72665777-72665799 ATCTGGGCTCAAAGTGAGGGTGG - Intronic
1086815906 11:91370393-91370415 ATGTGGGCCCAGAATGAGGAGGG + Intergenic
1087491809 11:98837547-98837569 ATATGGGGTCAGAATGTGAAAGG - Intergenic
1088960619 11:114661120-114661142 AAATGGGCTCTGTTTGTGGATGG + Intergenic
1089384637 11:118059751-118059773 ATCTGGGCTCAGAGTGAGGCAGG - Intergenic
1090484502 11:127100797-127100819 ATGTAGGCTCAGTGTGAGGAAGG + Intergenic
1091202873 11:133795601-133795623 ATTTGGGGTCAGACTGAGAAGGG + Intergenic
1091357389 11:134947898-134947920 ATATGGGCACAGTTTGATTAGGG + Intergenic
1093990915 12:25589455-25589477 ATAGGGGCTGGGATTGGGGATGG + Intronic
1097902997 12:64891814-64891836 GTAGGGGCTCACATTGGGGAGGG - Intergenic
1097903016 12:64891902-64891924 GTAGGGGCTCACATTGAGGAGGG + Intergenic
1098606383 12:72395883-72395905 TCATTGGCTAAGATTGAGGAAGG - Intronic
1098906026 12:76163413-76163435 ATCTGATTTCAGATTGAGGAAGG + Intergenic
1099280686 12:80642058-80642080 GTAAGGGCTCTGATTGAGCAGGG - Intronic
1107186960 13:37534451-37534473 GTATGGGCTGAGATTCAGGAAGG + Intergenic
1108235433 13:48398271-48398293 ATATTGGGTCAGAGTGAGAAAGG - Intronic
1111754751 13:92379267-92379289 ATATGAGCTCTGATTTAGAAGGG - Intronic
1111781636 13:92734624-92734646 ATATGGACTAAGAGTGAGAATGG - Intronic
1111990217 13:95108872-95108894 ATATGGGGGCAGGTTGAGGGAGG - Intronic
1112143209 13:96669488-96669510 ATCTGAGCTCACATTGAGGAAGG + Intronic
1112571196 13:100595099-100595121 TTATGGGCTCAGAATGGAGAAGG - Intergenic
1113531651 13:111031943-111031965 CCATGGCCTCAGCTTGAGGATGG + Intergenic
1114372839 14:22109494-22109516 AAAAGGGGTCAGATTTAGGAAGG - Intergenic
1119727428 14:76930161-76930183 AGATGAGCTCAGACTGGGGAAGG - Intergenic
1121111193 14:91314206-91314228 ACATGGGCTCACACTGGGGATGG + Intronic
1122047526 14:99034556-99034578 ATATGGGCGCAGAAAGAGCAGGG - Intergenic
1123182937 14:106486611-106486633 ATCTGGGGTCAAATTGAGGTGGG + Intergenic
1123983237 15:25622376-25622398 ACATGGGCTGTGATTCAGGACGG - Intergenic
1124077413 15:26459518-26459540 ATATGGGCCCAGAATGGGCATGG + Intergenic
1125126050 15:36222023-36222045 TTATGGGCTCAGAATGGGGGAGG - Intergenic
1127627067 15:60790029-60790051 ATAGGTTCTCAGATGGAGGAAGG - Intronic
1132503065 16:293213-293235 GACTGGGCTCAGGTTGAGGAGGG + Intronic
1133383990 16:5354109-5354131 ACTTGAGCTCAGATGGAGGAGGG - Intergenic
1134194758 16:12150869-12150891 AGAAGCGCTCAGATGGAGGAGGG + Intronic
1134782911 16:16914875-16914897 CTATGGGGTCAAATTGAAGAAGG + Intergenic
1136251290 16:29007185-29007207 ATATGGGTTCAAATTGACAAGGG + Intergenic
1137499590 16:49000266-49000288 ATCTGGGCTCAGATTGGATAAGG + Intergenic
1137873769 16:51975654-51975676 ATATGGGGTCAAAGTGAGTAGGG - Intergenic
1139327114 16:66161152-66161174 ACATTGGCCCAGATTGAGAAAGG - Intergenic
1140394333 16:74614062-74614084 AAATTGGCTCAGATTGGGCAGGG + Intergenic
1140819043 16:78646371-78646393 AGAAGGGCTAAGATGGAGGATGG - Intronic
1143542947 17:7580373-7580395 ATATAGGCTCAGAGGGAAGAAGG + Intronic
1143612636 17:8028420-8028442 ATGTGGGCTGAGAATGGGGAAGG + Intergenic
1144423160 17:15116252-15116274 TTATGGGCTCAGAATAGGGAGGG - Intergenic
1145043955 17:19597683-19597705 TTATGGGCCCAGAGCGAGGAGGG - Intergenic
1156285878 18:35695436-35695458 TTATGGGCTGAGAGTGAAGAAGG + Intronic
1157423721 18:47567526-47567548 AGATGGGCTGAGAATGAGGATGG - Intergenic
1158171245 18:54603135-54603157 ATATGGACCCAGATGGAGAAAGG + Intergenic
1159299580 18:66545424-66545446 ATATGGGGGCAGAGAGAGGAAGG - Intronic
1159657351 18:71048080-71048102 AAAGAGGCTGAGATTGAGGAAGG - Intergenic
1160770483 19:828706-828728 GAAGGGGCTCAGATGGAGGAGGG + Intronic
1160770571 19:829006-829028 GAAGGGGCTCAGATGGAGGAGGG + Intronic
1161041877 19:2114717-2114739 ATATGGGTTCAGGGTGAGGGTGG - Intronic
1162222546 19:9190067-9190089 TTATGGGCTCAGAATGGGGGAGG + Intergenic
1168358149 19:55715129-55715151 ATTTGAGCCCAGATCGAGGAGGG + Exonic
1168567428 19:57436395-57436417 ATATGGGCTGAGGTAGGGGAGGG + Intronic
926300897 2:11601428-11601450 ATATGTGTTCAGTTTGAGGAAGG - Intronic
930509442 2:52326399-52326421 AGATGAGCTCAGAGTCAGGAGGG + Intergenic
933074570 2:77907177-77907199 TTATGGGCTCAGAATAGGGAAGG - Intergenic
933582342 2:84141961-84141983 ATATTGGCTCAGGTTGAGGTTGG - Intergenic
934144800 2:89081258-89081280 ATGTGGGCTCAGGTTGGAGAAGG + Intergenic
934149873 2:89135949-89135971 ACATAGGCTCAGGTTGAGCAGGG + Intergenic
934217424 2:90046082-90046104 ACATAGGCTCAGGTTGAGCAGGG - Intergenic
934224457 2:90119293-90119315 ATGTGGGCTCAGGTTGGAGAAGG - Intergenic
936811530 2:116408258-116408280 TTATGGGCTCATATGCAGGAGGG + Intergenic
937737481 2:125310076-125310098 ATGTGGGCTCACATTTAGGGTGG + Intergenic
937849791 2:126621824-126621846 TTATGGGCTCAGAATGGGGGAGG + Intergenic
938290694 2:130148414-130148436 ATCTGTGCTCTGATTGATGATGG - Intergenic
938465850 2:131524539-131524561 ATCTGTGCTCTGATTGATGATGG + Intergenic
938573474 2:132583640-132583662 ATATGGGTTGAGATTGAAGAGGG + Intronic
939128716 2:138207675-138207697 AAATGTCCTCTGATTGAGGAAGG - Intergenic
939591192 2:144065640-144065662 ATATGGGCAAAGTTTAAGGAAGG - Intronic
939659658 2:144872448-144872470 ATATGGGCTCCGGTTAAGGAAGG - Intergenic
941432921 2:165433697-165433719 ACATGGCTTCAGAATGAGGAAGG - Intergenic
942145405 2:173021894-173021916 TTATGGGCTCTGATGGATGAGGG - Intronic
942964369 2:181873230-181873252 AAATGGGGTCATATTGAAGAAGG + Intergenic
946908479 2:224438287-224438309 ATATCGACTCACATTGAGGAGGG - Intergenic
947434463 2:230060938-230060960 TTATCGGCTGAGAATGAGGAGGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169153379 20:3308083-3308105 AGAAGGGCTCTCATTGAGGAAGG - Intronic
1169819573 20:9694537-9694559 ACTTGGGCACAGCTTGAGGAAGG - Intronic
1172405705 20:34687323-34687345 CTTGGGTCTCAGATTGAGGAGGG - Intergenic
1172579415 20:36035194-36035216 ACATGGGATCAGATTCAGGCAGG + Intergenic
1172920740 20:38479836-38479858 ATATAGGCTAAGGTTGAGGGCGG - Intronic
1173246366 20:41340565-41340587 AAATGGGATCAAATTGAGGAAGG + Intergenic
1176524898 21:7858581-7858603 TTATGGGCTCAGAATGTGGGAGG + Intergenic
1178658918 21:34488594-34488616 TTATGGGCTCAGAATGTGGGAGG + Intergenic
1179099540 21:38344692-38344714 ATATCCTCTCAGTTTGAGGAGGG + Intergenic
1181483102 22:23213411-23213433 CTATGGGCTCAAATTCCGGAGGG + Intronic
1182965981 22:34521405-34521427 ATATGGGTTCAAATTGACAAGGG + Intergenic
1183336271 22:37248697-37248719 ATTTGGGCTGAAAATGAGGAAGG - Intergenic
1183730221 22:39614389-39614411 ATCTGGGCTCAGCTGGAGGGAGG + Intronic
1183783604 22:40016014-40016036 ATTTGGGCCAAGATTTAGGATGG + Intronic
1184539650 22:45112272-45112294 AAAAGGGCACAGATTCAGGAAGG - Intergenic
1185133516 22:49055289-49055311 AAATTGGCTCAGCTTGAGCACGG - Intergenic
949621612 3:5818951-5818973 ATATGGGCCAAGACTGAGCAAGG - Intergenic
951459501 3:22934731-22934753 ATATGGGCTCAATGTGAGCATGG - Intergenic
951896558 3:27614933-27614955 CTATGGGCTCAGAATGGGGGAGG + Intergenic
952599028 3:35056312-35056334 ATATGGGCACATTTTGAGTAGGG + Intergenic
954737922 3:52722107-52722129 TTATGGGCTCAGAATAAGGGAGG - Intronic
955666036 3:61350053-61350075 CTATGGGCACGGATTGAGGCAGG + Intergenic
957075314 3:75598052-75598074 TTAAGGGCCAAGATTGAGGAAGG + Intergenic
957258218 3:77866217-77866239 ATATTGGCTCATACTGGGGAAGG + Intergenic
957332261 3:78780392-78780414 ATCTGGGCTCAGTTAGAGCAAGG + Intronic
958449840 3:94259654-94259676 TTATAGGCTCAGAATGGGGAAGG - Intergenic
960619167 3:119622615-119622637 TTATGGGCTAACATTGGGGAAGG - Intronic
960728020 3:120691325-120691347 AAATGGTCTCTGATTTAGGATGG + Intronic
960729491 3:120710535-120710557 ATGTGGGCACAGATGGAGAAAGG - Intronic
961092611 3:124127462-124127484 GTTTGGGGTCAGATTGAGAAGGG - Intronic
962493485 3:135916774-135916796 ATTTGGGCTCATTTTGAAGATGG + Intergenic
963907110 3:150781769-150781791 ATAAGGTCTGAGAGTGAGGAAGG + Intergenic
966300362 3:178472251-178472273 ATATGGGCTCAGCCTGAAGAGGG + Intronic
966861689 3:184234134-184234156 ATATGGGGTCAGATGGACGAGGG - Intronic
966984942 3:185171742-185171764 AGATGGGCTAAGTTTCAGGATGG + Intergenic
967165075 3:186773083-186773105 ATGTGGGCCCATATTGAGGTAGG - Intergenic
968694748 4:2018449-2018471 ATCTGGGCTCAGATGGTTGATGG - Intronic
971166688 4:24190814-24190836 AAATGGGCTGAGCTTGAGAAGGG - Intergenic
976311264 4:83615528-83615550 AGATTGGCTCAGATCCAGGAGGG - Intergenic
981940908 4:150280720-150280742 ATATGGGCTCAGATTGAGGAAGG + Intronic
983646475 4:169996685-169996707 AGAAGGGCTCAGATGGAGGAAGG + Intronic
985106649 4:186506244-186506266 ATAGGGGCATGGATTGAGGAAGG - Intronic
986076121 5:4339954-4339976 AAATGGGCTCAGAGTGATGTAGG + Intergenic
987241330 5:16003279-16003301 ACGGGGGCTCAGAATGAGGAAGG - Intergenic
989116745 5:37962189-37962211 AGTTGGGATCAGATTGAAGAAGG + Intergenic
990935128 5:61139865-61139887 TTATGGGCTCAGAATGGGAAAGG - Intronic
991370662 5:65916160-65916182 ATACGGGCTCAGGTAGAAGAAGG - Intergenic
995320707 5:110830628-110830650 TTATAGGCTCAGAATGGGGAGGG - Intergenic
995324640 5:110875972-110875994 ATATCCTCTCAGATTGAGGGTGG + Intergenic
995942812 5:117605428-117605450 ATTTGGGCTGAGAGTGATGATGG + Intergenic
996625051 5:125560809-125560831 AGATGGGATCAGCTTGAGGTTGG + Intergenic
998980990 5:147701992-147702014 ATATGGACTCAGAATGAGAAGGG - Intronic
999393632 5:151212552-151212574 ACATGAGCTCAGATTGGGGCTGG + Intronic
999713927 5:154343826-154343848 AAGTGGGCTCATATTGAGGAAGG - Intronic
1000473406 5:161674958-161674980 ATATGTGTGCAGATTGAGCATGG + Intronic
1001048199 5:168391894-168391916 AAATGGGCTGATAGTGAGGAAGG + Intronic
1001607876 5:172975937-172975959 ATATTGGCTATGATTGACGAAGG + Intergenic
1005811713 6:29520893-29520915 CTATGGGCTCACACTCAGGAGGG + Intergenic
1007019219 6:38502738-38502760 ATATGGCATCAGATTCATGAAGG + Intronic
1008008291 6:46436053-46436075 ATATGTGCTCAGATTTCAGAAGG + Intronic
1008334758 6:50289058-50289080 ATATTGACTCACATTGAGCAGGG + Intergenic
1010104439 6:72150148-72150170 TTATGGGCTCAGAATGGGGAGGG + Intronic
1011416705 6:87129341-87129363 ATAAGGGCTGAGGTTGAGGCTGG + Intergenic
1014162006 6:118180726-118180748 ATATGAACTCAGATTCCGGAAGG + Intronic
1015237204 6:130985250-130985272 TTATGGGCTCAGAGTGGGGGAGG - Intronic
1016132208 6:140488260-140488282 ATATGGGCTCAGAATAGGGGAGG + Intergenic
1016489717 6:144584573-144584595 ATATGGCAGCAGATTGAGGTGGG + Intronic
1021162502 7:17293178-17293200 GTATGGGGTCTGAGTGAGGAGGG + Intergenic
1022469780 7:30675074-30675096 ACCTGGGCTCAGATTTAGCAGGG - Intronic
1023853669 7:44166238-44166260 TTATGGGCTCAGAATGGGGGAGG + Intronic
1028231537 7:88311518-88311540 ACATGTGGTCAGAATGAGGAAGG + Intergenic
1028469021 7:91184796-91184818 AGTTGGGGTCAGATTGAGAAGGG + Intronic
1029166893 7:98598463-98598485 ATAGGGACTTAGATTGAGGGGGG - Intergenic
1032018564 7:128394296-128394318 ATGTCGGCCCAGATTGAGGGTGG - Exonic
1032455416 7:132069675-132069697 ATATGGTCTCAGACCCAGGAAGG - Intergenic
1036082139 8:5568356-5568378 TTATGGGCTCAGAATGGGGAGGG + Intergenic
1036085354 8:5607527-5607549 CCATGGGCTGAGAATGAGGAAGG + Intergenic
1036612152 8:10359701-10359723 GGATGGTCTCAGATGGAGGATGG + Intronic
1036612160 8:10359752-10359774 GGATGGTCTCAGATGGAGGACGG + Intronic
1037608629 8:20458221-20458243 AGATGGGCTCTGATCCAGGAAGG - Intergenic
1039398806 8:37249991-37250013 ATTTGGGCTGGGCTTGAGGAAGG + Intergenic
1040106228 8:43543762-43543784 ATATGCGCCCACATTGGGGAGGG + Intergenic
1041328653 8:56698253-56698275 AAATGGGCTCAGATGGAAAAGGG - Intergenic
1041360583 8:57049443-57049465 TCATGGGCTCAGAATGGGGAAGG - Intergenic
1041950610 8:63496757-63496779 ATATCCACTCAGATTGAGGGTGG + Intergenic
1042590261 8:70391322-70391344 TTTTAGGCTCAGATTAAGGAGGG - Intronic
1042716009 8:71773237-71773259 TTATGGGCTCAGAATGGGGGAGG + Intergenic
1044018574 8:87076088-87076110 AGATGGGATAAGAGTGAGGAAGG + Intronic
1045222074 8:100208885-100208907 ATATGGGTTCAAATTGACAAGGG + Intronic
1046669373 8:117041238-117041260 AGTGGGGCTCAGATTGAGGGAGG + Intronic
1047275477 8:123402047-123402069 ATGTCGGCCCAGATTGAGGGTGG + Intronic
1047719169 8:127622996-127623018 GTTTGGGCTCAGAATGAAGAAGG + Intergenic
1048860558 8:138721878-138721900 TTATGGGGTCAGATGGGGGAAGG - Intronic
1048919765 8:139217715-139217737 ATCTGGGCCAAGATTGAGCACGG - Intergenic
1048966054 8:139615439-139615461 AAATGGTCTCAGAGTGGGGAGGG - Intronic
1049634843 8:143682118-143682140 TTATGGACTCAGAATGGGGAGGG + Intergenic
1049905089 9:209118-209140 ATGTGAGCTCAGGTTGAGAAAGG + Intergenic
1056879729 9:90379717-90379739 ATGTAAGCTCTGATTGAGGATGG + Intergenic
1058675173 9:107394086-107394108 AGGTGGGCTCAGAATGAGCAGGG - Intergenic
1059311005 9:113389176-113389198 AGATGGTCACAGATTGAGCAGGG - Intronic
1059847752 9:118300120-118300142 ATCTGTGCTTAGATTGAGGATGG + Intergenic
1061223242 9:129264736-129264758 ATGTGGGCTGGGATTGAGGAAGG + Intergenic
1189971384 X:46421343-46421365 TTATGGACTCAGAATGGGGAGGG - Intergenic
1190705576 X:53024147-53024169 TTATGGACTCAGAATGGGGAGGG - Intergenic
1194026009 X:88751844-88751866 AGATGGAGTCAGATTGTGGAGGG + Intronic
1194360049 X:92938618-92938640 ATATGGGTTTAGAGTTAGGACGG - Intergenic
1195620522 X:106950055-106950077 ATCTGTGTTCAGCTTGAGGACGG + Intronic
1196154818 X:112417211-112417233 AAGTGGGCACAGATTGAAGATGG + Intergenic
1196292969 X:113965557-113965579 ATTTGGCCTCAAGTTGAGGACGG - Intergenic
1199807988 X:151320533-151320555 TTATGGCCTTAGATTAAGGAAGG - Intergenic
1200668245 Y:6054439-6054461 ATATGGGTTTAGAGTTAGGACGG - Intergenic