ID: 981941291

View in Genome Browser
Species Human (GRCh38)
Location 4:150284104-150284126
Sequence CAGCAGGGTCAGCATCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 314}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981941291_981941295 5 Left 981941291 4:150284104-150284126 CCTGTGGGATGCTGACCCTGCTG 0: 1
1: 0
2: 1
3: 27
4: 314
Right 981941295 4:150284132-150284154 CTGTAGATATGCAGCCAGGAAGG No data
981941291_981941297 14 Left 981941291 4:150284104-150284126 CCTGTGGGATGCTGACCCTGCTG 0: 1
1: 0
2: 1
3: 27
4: 314
Right 981941297 4:150284141-150284163 TGCAGCCAGGAAGGGAATGAAGG 0: 1
1: 1
2: 4
3: 43
4: 549
981941291_981941294 1 Left 981941291 4:150284104-150284126 CCTGTGGGATGCTGACCCTGCTG 0: 1
1: 0
2: 1
3: 27
4: 314
Right 981941294 4:150284128-150284150 GACACTGTAGATATGCAGCCAGG 0: 1
1: 1
2: 0
3: 10
4: 118
981941291_981941296 6 Left 981941291 4:150284104-150284126 CCTGTGGGATGCTGACCCTGCTG 0: 1
1: 0
2: 1
3: 27
4: 314
Right 981941296 4:150284133-150284155 TGTAGATATGCAGCCAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981941291 Original CRISPR CAGCAGGGTCAGCATCCCAC AGG (reversed) Intronic
900090063 1:916333-916355 CAGCATGGACAGCAGCCCAGAGG - Intergenic
900126904 1:1072776-1072798 CACCGGGGTGAGCCTCCCACAGG + Intronic
900955386 1:5883499-5883521 CAGCAGGGGCAGCAGCTCACGGG + Intronic
901319474 1:8330690-8330712 CATCAGCGTCAGCTTCCCCCGGG + Exonic
901424294 1:9171601-9171623 CAGCAGGGCCATACTCCCACTGG - Intergenic
901701538 1:11047104-11047126 CAGGAGGGTCAGCAGCCTATGGG + Exonic
902142893 1:14371214-14371236 CAGCAGCATCAGCATCCCCCAGG - Intergenic
902834133 1:19035854-19035876 CAGCAAGGTCAGAATCCCAGGGG + Intergenic
903192244 1:21663312-21663334 CAGCAGGCTCAGGATGCCATGGG - Intronic
903448790 1:23438802-23438824 CAGCAGGGTCAGCTTCACCGGGG + Exonic
903643615 1:24876906-24876928 CAGCAGTGTCAGCATCACTTGGG + Intergenic
904126089 1:28240307-28240329 CAGCAGTGTCAGCATCACCTGGG + Intronic
904373750 1:30066619-30066641 CAGCAGGGGCTGCACCCCATGGG - Intergenic
904612488 1:31733104-31733126 CAGCAGGGGCAGCACCACGCAGG + Exonic
905340198 1:37272818-37272840 CAGCAGGGTCTGCTTCCTAAGGG + Intergenic
906350786 1:45057136-45057158 CAGCAGCATCAGCATCCCCTGGG + Intronic
906483705 1:46218793-46218815 TAGAAGGATCAGAATCCCACTGG - Intronic
906712382 1:47940616-47940638 CTGCAGGGCCAGGACCCCACAGG + Intronic
908556273 1:65259709-65259731 CAGCAGCATCAGCATCACTCAGG + Intronic
910264558 1:85324690-85324712 CAGCTGGGTCAGCCTCCCTGGGG - Intronic
910462868 1:87467280-87467302 CAGCAGCTTCAGCATCACCCAGG + Intergenic
911111363 1:94190758-94190780 CAGGAGGGTCAGTATCTCATCGG - Intronic
912474836 1:109928746-109928768 CAGCACCGCCAGCAGCCCACAGG + Intronic
915033090 1:152901012-152901034 CAACAGGGGCAGCATCCCGGAGG - Intergenic
915640258 1:157219221-157219243 CAGGAGGGTCAGCATCACCTGGG + Intergenic
915674056 1:157514609-157514631 CAGCAGCATCAGCATCCCCTGGG + Exonic
915895742 1:159809433-159809455 CAGCAGGGTCAGCAGGCCCGTGG - Exonic
916172010 1:162008646-162008668 CAGCAGCATCAGCATCACACAGG + Intronic
916733566 1:167587447-167587469 CAGCAGCTTCAGCCTCCCCCTGG - Intergenic
916739852 1:167638480-167638502 GAACAGGGACAGGATCCCACCGG - Intronic
919547920 1:198947045-198947067 CAGCAGATTCAGCATCTCCCAGG - Intergenic
919668123 1:200312326-200312348 CAGCACGGCAAACATCCCACAGG + Intergenic
919743381 1:200993827-200993849 CAGCAGGGTCAGCTTCTTTCTGG + Intronic
920577266 1:207070655-207070677 CAGGAGTGTCAGCATGACACTGG - Intronic
920674184 1:208027972-208027994 CAGCAGGGACAGAAACCAACAGG - Intronic
921050140 1:211505344-211505366 AAGCAGAGACAGCATCCCAAGGG - Intergenic
921369402 1:214406081-214406103 CATCATCTTCAGCATCCCACAGG + Intronic
921684540 1:218074950-218074972 CAGCAGAGTCACCATCCCCGAGG - Intergenic
923316946 1:232789606-232789628 CAGCAGCGTCAGCATCACCTGGG - Intergenic
1065316931 10:24472808-24472830 CGGCAGGGTCATCCTCCCTCTGG + Intronic
1065420350 10:25536836-25536858 CAGCAGGATTAGCATCCCGAGGG + Intronic
1066096892 10:32080827-32080849 TAGCAGGGTCAGCATTCCCATGG + Intergenic
1067288276 10:44923262-44923284 CAGCTGGTTCAGCATTGCACAGG - Intronic
1067414833 10:46095302-46095324 CTACAGGCCCAGCATCCCACAGG - Intergenic
1071394915 10:85213436-85213458 GAGCAAGGTCAGCTTCCCATAGG + Intergenic
1071982851 10:91021314-91021336 CAGCAGCGTGAGCATCACCCAGG + Intergenic
1072755425 10:98017674-98017696 CAGGAGTGTTAGCACCCCACTGG - Intronic
1072913031 10:99520569-99520591 CAGCAGGGTCCGCAGAGCACAGG + Intergenic
1072989536 10:100178543-100178565 CAGCAGTATCAGCATCACCCAGG + Intronic
1073284493 10:102379488-102379510 GAGCAGGGTCAGGATCCTTCAGG - Intronic
1073335496 10:102704877-102704899 CTGCAGCATCTGCATCCCACTGG - Intronic
1073378607 10:103059344-103059366 CTGCAGGGAGAGCATCTCACTGG - Intronic
1073474071 10:103741535-103741557 CAACAGGGTCAGCAGCCCCTTGG + Intronic
1073474195 10:103742216-103742238 CAGCAGGGTCACGCTCCCTCTGG + Intronic
1073592976 10:104773892-104773914 CAGCAGTGTCAGCATCACCTGGG + Intronic
1073713603 10:106075243-106075265 CAGCAGCATCAGCATCACCCAGG + Intergenic
1074196144 10:111187182-111187204 CAGCCAGGTCAGTTTCCCACTGG - Intergenic
1075046109 10:119147696-119147718 CACCAGGGTCAGTATCTGACAGG + Intronic
1075778955 10:125004841-125004863 CAGCAGGCTCAGGGTCCCACAGG + Intronic
1076176150 10:128369463-128369485 CAGCAGTGCCAGCTGCCCACAGG - Intergenic
1076440261 10:130476636-130476658 CAGCAGGGTCGGCCTCCTCCAGG + Intergenic
1076495694 10:130896134-130896156 AAGCAGGGTCAGCAACACACTGG - Intergenic
1076597125 10:131630783-131630805 CTGCAGGCTCTGCAGCCCACAGG + Intergenic
1077025491 11:438145-438167 CAGCAGGATCAGCCTCCCCTGGG + Intronic
1077183620 11:1227085-1227107 CATCAAGGTCAGCATCCGGCTGG + Exonic
1077407848 11:2390697-2390719 CAGAAGGGCCAGCAGGCCACAGG - Intronic
1078088713 11:8250726-8250748 CAGCAGAGGCTGCATCCGACTGG - Intronic
1080249322 11:30215309-30215331 CAGCAGGATCAGCATCACCTGGG - Intergenic
1080954872 11:37081761-37081783 CAGCATGGTTAGCATCCTCCAGG - Intergenic
1082763468 11:57148395-57148417 CAGCATGGCCACCATACCACAGG + Intergenic
1083432374 11:62620721-62620743 CAGAATGTTCAGCATCCCAAAGG + Intronic
1083487964 11:62995493-62995515 CATCAGGGTCTGCTTCCCTCTGG - Intronic
1084227001 11:67722615-67722637 CAGCTGTGTCAGCACCCCCCAGG - Intergenic
1084496996 11:69510915-69510937 CGACCTGGTCAGCATCCCACTGG + Intergenic
1085048640 11:73368067-73368089 CAGCTGGGTCTGGACCCCACGGG + Exonic
1085366791 11:75955105-75955127 CAGCAGGGTCTACATCACAAAGG + Intronic
1085690931 11:78663149-78663171 CAGCAGGCTCAGCCTTCCTCAGG + Intronic
1089345380 11:117787966-117787988 CAGTAGGGTGATCCTCCCACCGG + Intronic
1091319705 11:134640822-134640844 CCCCAGGGTCAGCATCTCCCTGG - Intergenic
1091768390 12:3136709-3136731 CAGGAGCTTCAGCTTCCCACGGG - Intronic
1091781505 12:3216947-3216969 CAGGAGGCTCAGCTTCCCCCAGG - Intronic
1092238535 12:6823963-6823985 CAGCAGCGCCAGGAGCCCACAGG - Exonic
1092278463 12:7081017-7081039 CCGCAGGGTCAGCGTCCACCCGG - Exonic
1094480297 12:30876106-30876128 TGGCAGGGTCTGCCTCCCACTGG - Intergenic
1097176786 12:57147871-57147893 CAGGAGGGTCAGCAGCCCTGGGG - Intronic
1097376019 12:58844017-58844039 CAGCAGGGTCAGTTTCCCCAGGG - Intergenic
1100231191 12:92609740-92609762 CAGCAGCATCAGCATCACCCGGG - Intergenic
1102000899 12:109557598-109557620 CAGCAGTGTCAGCATCAGCCAGG - Intronic
1103863665 12:124034279-124034301 CAACAGCGTCAGCATCCCCTGGG - Intronic
1104757699 12:131279294-131279316 CAGCAGGAGCAGCTTCACACAGG + Intergenic
1104775371 12:131387508-131387530 CAGCAGGAGCAGCTTCACACAGG - Intergenic
1107198491 13:37683594-37683616 CAGGAGGGTCAGCATCACACAGG + Intronic
1108095108 13:46893396-46893418 CAGCAGCATCAGCATCACCCGGG - Intronic
1110172986 13:72524448-72524470 CAGCAGGGTCAGGATCACCCAGG + Intergenic
1112563245 13:100532213-100532235 CAGCAGGGCCACCTTCCCGCCGG - Exonic
1113801789 13:113090478-113090500 CAGCAAGGTCAGCACCCTGCAGG - Intronic
1114673774 14:24428405-24428427 CAGCAGGCTCTGCTTCCCCCAGG - Exonic
1115461541 14:33666451-33666473 TAGCAGGTTCAGCATCACCCAGG + Intronic
1117062760 14:51980248-51980270 CAGCTGGGGCAGGATCCCAAGGG - Intergenic
1117978557 14:61321205-61321227 CTGCAGGGTCACCAGCCCACCGG + Intronic
1121328754 14:93036616-93036638 CACCAGGCTCAGCACCCCAGGGG + Intronic
1121612002 14:95287629-95287651 CAGCAGCATCAGCATCACCCAGG - Intronic
1121919747 14:97869576-97869598 CACCAAGGTCACCGTCCCACTGG + Intergenic
1122155482 14:99747822-99747844 CTGCAGGGTCAGCAATGCACGGG + Intronic
1122498263 14:102175002-102175024 CAGCAGAGTAAACAACCCACAGG - Intronic
1122723948 14:103738327-103738349 AAGCAGCCTCAGCATCCCCCTGG - Intronic
1122881829 14:104693745-104693767 GAGGAGGGCCAGCATCCCACTGG + Intronic
1124360852 15:29035720-29035742 CAGCAGCCTCAGCATCCCCTGGG + Intronic
1124490851 15:30154148-30154170 GGGCAGGGTGAGCATCCCAGAGG + Intergenic
1124752682 15:32384182-32384204 GGGCAGGGTGAGCATCCCAGAGG - Intergenic
1126014843 15:44340593-44340615 CAGCAGTGTCAGCATTACCCAGG + Intronic
1126498739 15:49321285-49321307 CAGCAGGATCAGCATGGCAGAGG + Intronic
1126579604 15:50230906-50230928 CAGCAGTGTCAGCATCACCCAGG + Intronic
1127658321 15:61076252-61076274 CAGCAGCGTCAGCATCACCTGGG - Intronic
1128310961 15:66631604-66631626 CAGCAGACCCAGCACCCCACAGG - Intronic
1128378227 15:67092436-67092458 CAGCAGCGTCAGCATCACCAGGG + Intronic
1128458135 15:67844411-67844433 CAGCACAATCACCATCCCACAGG - Intergenic
1129743492 15:78001806-78001828 CAGTAGGGCCAGCACCCCCCTGG - Intronic
1130518551 15:84644916-84644938 CAGCAGGGACAGCACCTCAAGGG - Intronic
1131670058 15:94610348-94610370 CAGCAGCATCAGCATCACCCAGG + Intergenic
1132104894 15:99056346-99056368 CAGCAGGGCCAGGATCCATCTGG - Intergenic
1132231673 15:100189107-100189129 CAGCAGCGTCTGCATCACCCTGG - Intronic
1132744506 16:1431122-1431144 CAGCAGCGTCTGCCTCCCCCAGG - Intergenic
1132869147 16:2107966-2107988 CAGCACGGTCACCATTCCACGGG - Exonic
1133336756 16:5011356-5011378 CAGCTGGGTCAGCTTCTCCCGGG + Intronic
1133911515 16:10070317-10070339 CAGCAGCATCAGCATCTCCCAGG + Intronic
1134550199 16:15135363-15135385 CAGCACGGTCACCATTCCACGGG - Intronic
1134718270 16:16367632-16367654 CAGCACGGTCACCATTCCACGGG + Intergenic
1134956482 16:18384527-18384549 CAGCACGGTCACCATTCCACGGG - Intergenic
1136087491 16:27895989-27896011 CAGCAGCGTCAGCATTCCCTGGG + Intronic
1136248921 16:28990930-28990952 CAGCAGCATCAGAATCACACAGG - Intergenic
1137550517 16:49434476-49434498 GGGCGGGGTCAGCATCCCATGGG - Intergenic
1138148623 16:54635084-54635106 CAGCATGTTCAGCATCCCTTAGG - Intergenic
1138283607 16:55791347-55791369 CAGCAAGGTGGCCATCCCACAGG + Intergenic
1138285395 16:55805640-55805662 CAGCAAGGTGGCCATCCCACAGG - Intronic
1139333067 16:66209214-66209236 CAGCAGTGTTAGCATCACATGGG - Intergenic
1139641325 16:68293850-68293872 CAGCATGGTCAGCATCACCTTGG - Intronic
1140090396 16:71833734-71833756 CAGCAGGGTTACCATCTCCCAGG - Intergenic
1141281236 16:82631544-82631566 CAGGAGGGTCAGATTCTCACAGG - Intronic
1141619904 16:85231682-85231704 CAACATGGTCATCATCACACAGG - Intergenic
1141980544 16:87547474-87547496 CAGCAGGCTCAGCGACCCTCAGG + Intergenic
1142171461 16:88624794-88624816 CAGCAGTGCCAGCATCACAGTGG - Intronic
1143780350 17:9225858-9225880 CAGCAGGGGCAGCAAACCCCAGG - Intronic
1144394830 17:14833999-14834021 CAGCAGCATCAGCATCCCCTGGG + Intergenic
1144748546 17:17632506-17632528 CAGCAAGATCAGGAACCCACGGG - Intergenic
1146265946 17:31452883-31452905 CAGCAGGGGCAACATCCCCCAGG - Intronic
1146488012 17:33259891-33259913 CAGCAGCATCAGCATCCCCTGGG - Intronic
1147218048 17:38912348-38912370 CCGCAGGGTCAGATTGCCACAGG + Intronic
1147449215 17:40493508-40493530 CAGCCAGGTCAGCTCCCCACTGG - Intronic
1148217310 17:45840185-45840207 CAGCAGGGCCAGCAGGCCCCAGG - Intergenic
1149581550 17:57754112-57754134 CAGCAGCATCAGCATCCCCTGGG + Intergenic
1149856991 17:60091382-60091404 CAGAAAGGTCAGCTTCCTACTGG - Intergenic
1150122551 17:62616304-62616326 CAGCAGCGTCAGCATCACCCGGG + Intergenic
1151569577 17:74919536-74919558 CCGCAGCATCAGCGTCCCACTGG - Exonic
1151595722 17:75077152-75077174 AAGCAGGGTCAGCAGCCTCCAGG - Intergenic
1151667492 17:75553682-75553704 CTGCAGGGTCACTATCCCCCGGG + Intronic
1152101752 17:78305528-78305550 AAGCAGGGTCAGCAGCCCCTGGG - Intergenic
1152431407 17:80250086-80250108 CTGCAGGGTCAACATCCCAGGGG + Intronic
1152600074 17:81257828-81257850 CAGCAGGGCCCGCACCCCTCGGG - Intronic
1152896548 17:82914594-82914616 CAGCATGGGCAGCTTTCCACGGG - Intronic
1154323620 18:13374441-13374463 CAGCAGCATCAGCATCCCCTGGG + Intronic
1157572573 18:48722851-48722873 TAGCAGGCTGTGCATCCCACTGG + Intronic
1157811162 18:50697012-50697034 CAGCAGCATCAGCATCCCCTCGG + Intronic
1159342904 18:67160201-67160223 CAGCAGCATCAGATTCCCACAGG - Intergenic
1160900729 19:1426819-1426841 AGGCCGGGTCAGAATCCCACTGG - Intronic
1160993625 19:1871902-1871924 CAGCAGGGGCAGGATCCGGCTGG + Intergenic
1161026177 19:2038440-2038462 CAGCAGGCTCCGCAGCCCCCGGG + Exonic
1161094824 19:2384210-2384232 CAGCAGACACAGCATCCCAGGGG + Intergenic
1161144573 19:2670178-2670200 CAGCAGGGTCAGCCTCCTCAGGG + Intronic
1163785885 19:19274736-19274758 TAGCAGGGTCAACACCCCCCAGG + Intergenic
1164508145 19:28876062-28876084 CAGCAGGCTCAGCATCACCACGG + Intergenic
1166140031 19:40800548-40800570 CAGCAGTGTCTTCATCCCCCGGG - Exonic
1166811610 19:45517829-45517851 CAGCAGGTGCAGCTTCCCGCCGG + Exonic
1167512683 19:49904371-49904393 CAGCAGCATCAGCAACCGACTGG - Intronic
1168073573 19:53966042-53966064 TATCAGGGTCCCCATCCCACAGG + Intronic
1168083354 19:54026865-54026887 CAGCAGCGTCAGCATCACCTGGG + Intergenic
925195630 2:1922467-1922489 CAGCAGGGTCAGGTTCCCCTTGG + Exonic
925818168 2:7773729-7773751 CAGCAGGGGTAGCCGCCCACAGG - Intergenic
927084321 2:19659490-19659512 CAGCAGCGGCAGCATCCAGCAGG - Intergenic
930102716 2:47615679-47615701 CAGCAGGGTTAGCATCGCCTGGG - Intergenic
932132337 2:69199274-69199296 CAGCAGCATCAGCATCACATGGG - Intronic
933135972 2:78736264-78736286 CAGCAGAATCAGCATCCCAAAGG + Intergenic
933454195 2:82500609-82500631 CAGGAGGGTCAGTCTTCCACTGG - Intergenic
934085556 2:88506254-88506276 CAGCAGTATCAGCATCCCCTGGG + Intergenic
934767504 2:96888135-96888157 CTGGAGGGTCAGCTTCCCAGAGG + Intronic
935076400 2:99748553-99748575 CAGCAGGATGAGCATTCCAGGGG - Intronic
935203820 2:100881070-100881092 CAACAGCGTCAGCATCCCTGGGG - Intronic
935874220 2:107488602-107488624 GAGCACGTTCAGCTTCCCACTGG + Intergenic
936444851 2:112587318-112587340 TCGCAGGGACTGCATCCCACAGG - Intronic
936779038 2:116009816-116009838 CAGCAGCATCAGCATCCCCTGGG + Intergenic
936916070 2:117640199-117640221 CAGCAGAATCAGCACCCCATGGG + Intergenic
936937574 2:117853067-117853089 CAGCAGGACCAGCATCCCCTGGG + Intergenic
938604423 2:132877564-132877586 CAGCAGCGTCAGCCTCCCCTAGG - Intronic
943635483 2:190302159-190302181 CTGCAGGCTGACCATCCCACAGG + Intronic
944529093 2:200649968-200649990 CAGCTGGCACAGCATTCCACTGG + Intronic
944530693 2:200665027-200665049 CAGGAGGCTCAGCTTCTCACTGG + Intronic
944929160 2:204499009-204499031 CAGCAGTGTCAGCATCACCTGGG - Intergenic
945571949 2:211479198-211479220 CAGCAGTGTCAGCACCCCCTGGG - Intronic
946230818 2:218290339-218290361 GGCCTGGGTCAGCATCCCACAGG - Intronic
947229087 2:227867342-227867364 CAGCAGGGTCAGTATCACTTAGG - Intergenic
948577601 2:238964765-238964787 CAGCAGGGCCAGGACCCCGCAGG - Intergenic
948706963 2:239800933-239800955 CAGCAGGACCAGAAACCCACGGG + Exonic
1168932023 20:1631528-1631550 CTGTAGGGTCAGCATGCCTCAGG - Intronic
1168960297 20:1864395-1864417 CAGGAGCCACAGCATCCCACTGG - Intergenic
1169003226 20:2183619-2183641 CAACAGCTTCAGGATCCCACTGG + Intergenic
1169245003 20:4018206-4018228 CAGCAGGATCAGTATCTCCCAGG + Intergenic
1169270885 20:4198581-4198603 CAGCAGCATCAGCATCTCCCGGG + Intergenic
1170552337 20:17488749-17488771 CAGCTGGGGCTCCATCCCACTGG - Intergenic
1170759110 20:19234197-19234219 CAGCAGCATCAGCATCGCCCAGG + Intronic
1170784972 20:19459998-19460020 CAGCAGTATCAGCATCCCCTAGG - Intronic
1173451838 20:43171765-43171787 CAGCAGTGTCAGCATCACCTGGG - Intronic
1173579584 20:44137557-44137579 CAGCAGGGTCGCCAGCCCCCAGG - Intronic
1173703270 20:45091873-45091895 CAGCAGGGCCACCCTCCCTCTGG - Intergenic
1173907086 20:46637221-46637243 CAGCAGGGCCGGCTTCCCCCAGG - Intronic
1174097229 20:48098961-48098983 CAGCAGGGGCAAAATCCCAGAGG + Intergenic
1175304971 20:57969570-57969592 CAGCAAGGCCAGCATCCAAATGG - Intergenic
1175801132 20:61801611-61801633 CAGCAGGGCCATGCTCCCACTGG + Intronic
1177608671 21:23416955-23416977 GAGCAGGGTCATGTTCCCACTGG - Intergenic
1178216011 21:30598980-30599002 CAGCAGAGGTAGCATACCACTGG + Intergenic
1179175862 21:39007599-39007621 CAGCAGCGTCAGCATCACCTGGG + Intergenic
1179257175 21:39727036-39727058 CTGCAGGTTCAGCACCACACTGG - Intergenic
1179368994 21:40786436-40786458 CAGCAGCATCAGCAGCACACGGG + Intronic
1179377466 21:40863447-40863469 CAGCAGTGTCAGCATTCCCGAGG - Intergenic
1179539761 21:42076478-42076500 CAGCAGCGTCAGCGTCACCCAGG - Intronic
1179563065 21:42228954-42228976 CAGGAGGAGCTGCATCCCACTGG + Intronic
1180029966 21:45200260-45200282 CACCAGGGTGTCCATCCCACTGG + Intronic
1180156760 21:45981861-45981883 CAGCAGGGGCAGCAGAGCACGGG - Exonic
1181052355 22:20243844-20243866 CAGCAGGGATAGCCTCCCAGTGG + Intronic
1181546570 22:23605690-23605712 CACCAAGGCCAGCATCTCACTGG - Intergenic
1181674100 22:24440801-24440823 CAGCAGGGGCACCAGCACACAGG - Exonic
1183536394 22:38404074-38404096 CAGCTGGGTCCTCTTCCCACCGG + Intergenic
1184090720 22:42291697-42291719 CAGCCGGGTCAGGATCCACCTGG - Intronic
1184795099 22:46727730-46727752 GGGCCTGGTCAGCATCCCACAGG + Intronic
1185236430 22:49716237-49716259 CAGCAGAGACTGGATCCCACTGG + Intergenic
949842314 3:8333305-8333327 CAGCAGCATCAGCATCCCCTAGG + Intergenic
949877314 3:8634698-8634720 CAGCAGGGCCAGAAGCCCCCGGG + Intronic
950657552 3:14445997-14446019 CAGCAGCATCCGCATCACACTGG - Intronic
950721854 3:14888862-14888884 CAGCAGCGTCAGCATCACCTGGG + Intronic
950858753 3:16128887-16128909 CAGCAGCGTCAGCAACACCCGGG - Intergenic
950864222 3:16175825-16175847 CAGCAGCGTCAGCAGCCCCTGGG + Intronic
952327950 3:32337748-32337770 CAGCAGGATCAGTATCCCCCAGG - Intronic
952576552 3:34781127-34781149 CAGCAGCATCAGCATCACCCAGG - Intergenic
953410867 3:42689875-42689897 CAGCAGCGTCAGCATCTCCTGGG - Intronic
953419348 3:42742494-42742516 CACCAGGGGCCGCATCTCACTGG - Intronic
954153675 3:48672893-48672915 GAGCAGAGTCAGAAACCCACAGG - Intergenic
954220833 3:49152939-49152961 CACCAGGGTCAGCATCACTTTGG - Intergenic
955380123 3:58431699-58431721 CTCCAGGGTCTGCTTCCCACTGG + Intronic
962035252 3:131644471-131644493 CAGCAGTGTCAGCATCACATGGG - Intronic
962235856 3:133706485-133706507 CAGCAGCATCAGCATCCCCTAGG + Intergenic
962986426 3:140540377-140540399 CAGCTGTGTGAGCATCCCCCGGG + Intronic
966866694 3:184262029-184262051 CGGCAAGGGCACCATCCCACTGG - Intronic
968617327 4:1583641-1583663 CAGCAGGGTCAGGAGCACAAAGG - Intergenic
968960614 4:3741396-3741418 CAGCAGCGTGGGCAGCCCACAGG - Intergenic
969038902 4:4278312-4278334 CAGTGGGGTCAGAACCCCACTGG - Intronic
969306229 4:6327700-6327722 CAGCTGGGTCAGCAGGACACAGG - Intronic
969735001 4:8982235-8982257 CAGCTGTGTCACCACCCCACAGG + Intergenic
969934130 4:10664706-10664728 CAGCAGTGTCAGCATCACCAGGG - Intronic
971252541 4:24985434-24985456 CTGCTGCCTCAGCATCCCACTGG - Intergenic
972511540 4:39771746-39771768 CAGCAGCATCAGCATCCCTTGGG - Intronic
972671273 4:41215438-41215460 CAGCAGCATCAGCATCCCATGGG - Intronic
973621414 4:52729915-52729937 CAGCAGGGTCACTCTCCCTCTGG - Intronic
981941291 4:150284104-150284126 CAGCAGGGTCAGCATCCCACAGG - Intronic
982118343 4:152116203-152116225 CAGCCGGTTCAGCATTCCACAGG + Intergenic
983905502 4:173177221-173177243 CAGCAGCATCAGCATCCCCGGGG - Intronic
985589533 5:757399-757421 CAGGAGGGACAGCAGCCCCCTGG - Intronic
985604270 5:850122-850144 CAGGAGGGACAGCAGCCCCCTGG - Intronic
985678893 5:1245900-1245922 CAGCAAGGACAGCAGCACACAGG - Exonic
985729899 5:1541218-1541240 CAGCAGGGGCAAGAGCCCACTGG - Intergenic
987092651 5:14521849-14521871 CAGCAGGGTCAGCATGAGAAAGG + Intronic
987862520 5:23506376-23506398 CAGCAGGGGCAGCTTCCCTGTGG + Intergenic
988213701 5:28243858-28243880 CAGCAGGGCCATCACCCCCCTGG + Intergenic
988706877 5:33735306-33735328 CAGCAGCATCAGCATCACCCTGG - Intronic
990645838 5:57843791-57843813 CAGCATCTTCAGCATCTCACAGG + Intergenic
992464071 5:76986681-76986703 CAGTAGTGTCAGCATCACCCAGG - Intergenic
992890042 5:81195644-81195666 CAGCAGCATCAGCATCACCCGGG + Intronic
996491897 5:124107761-124107783 CACCAGGGACAGCATCACTCTGG - Intergenic
996945893 5:129067140-129067162 CAGCAGCATCAGCATCCCCTAGG + Intergenic
999707971 5:154291360-154291382 CAGCAGCGTCAGCATCACCTGGG + Intronic
1000334112 5:160229298-160229320 CAGCAGGGTCAGGATGGCAACGG - Intronic
1001000300 5:167999687-167999709 CAGGAGGGTCAGCAGCTCTCGGG + Intronic
1001084275 5:168689187-168689209 CAGCAGCATCAGCATCACATGGG - Intronic
1001579479 5:172789162-172789184 CACCAGTGCCACCATCCCACAGG - Intergenic
1001687528 5:173605336-173605358 CAGCAGTATCAGCATCACCCTGG - Intergenic
1004177150 6:13349822-13349844 CAGCAGCATCAGCATCACATAGG - Intergenic
1005391609 6:25339667-25339689 CAGCAGGGTCAGGTTGCCTCTGG + Intronic
1006794254 6:36721902-36721924 CAGCAGGACCTGCATGCCACTGG + Exonic
1007167380 6:39838377-39838399 CAGCAGCATCAGCATCACCCGGG - Intronic
1008678432 6:53845798-53845820 CAGCAGGGTTGGCATCCCCTGGG - Intronic
1010074429 6:71784106-71784128 CAGCAGGGGCACAATGCCACTGG + Intergenic
1010610947 6:77953327-77953349 GAGCAGGGTCACAATGCCACCGG - Intergenic
1011797739 6:90975875-90975897 CAGGATGGTCAGTAACCCACAGG - Intergenic
1011857057 6:91706259-91706281 CATCAAGGTCAGCATCTCAAAGG - Intergenic
1012038481 6:94173306-94173328 CAGCAAGATCAGGAACCCACCGG + Intergenic
1013275176 6:108578150-108578172 CAGCAGCGTCAGCATCACATAGG + Intronic
1013309923 6:108884271-108884293 CAGCAGCATCAGCATCCCCTGGG + Intronic
1016079079 6:139833790-139833812 CAGCATGGACAGCAGCCCATGGG + Intergenic
1017822148 6:158057272-158057294 CAGCAAGGTCGGCATCATACGGG - Intronic
1020007704 7:4791213-4791235 CAGCAGGGTCAGCAGCTCTGTGG - Exonic
1021568280 7:22036512-22036534 CAGCAGCATCAGCATCACATGGG - Intergenic
1022799399 7:33761392-33761414 CAGCAGCATCAGCATCCCCCAGG - Intergenic
1023920143 7:44622826-44622848 CAGCAGAGTCAGGATCCAAGCGG - Intronic
1024643572 7:51352459-51352481 GAGAAGCGTGAGCATCCCACTGG - Intergenic
1026481008 7:70779645-70779667 CAGCAGGGCAAGGATCCCTCAGG + Intronic
1032116995 7:129126285-129126307 CTGCAGCGTCAGCCTCCCTCGGG + Intergenic
1033368676 7:140690161-140690183 CAGCAGGGCCAGCGTGCCAGTGG - Intronic
1034945634 7:155260107-155260129 CAGCAGGGTCTGCATAACAGTGG + Intergenic
1035718058 8:1769017-1769039 CACCAGGGGCAGCATGACACGGG + Intronic
1036304840 8:7592778-7592800 CAGCTGGGTCACCACCCCCCAGG + Intergenic
1036355691 8:8040770-8040792 CAGCTGGGTCACCACCCCCCAGG + Intergenic
1036578321 8:10049519-10049541 CAGCAGCGTCAGCATCACCTAGG + Intergenic
1037215413 8:16445517-16445539 CAGCAGGGTCATGCTCCCTCTGG - Intronic
1037801395 8:22037724-22037746 CAGCAGGACCAGCTCCCCACTGG - Intergenic
1038619492 8:29126735-29126757 CAGCAGGGAGAGCATTGCACTGG - Intronic
1038704124 8:29878308-29878330 CAGCAGGGTCACACTCCCTCGGG + Intergenic
1039855298 8:41406845-41406867 ACACAGGGTCAGCTTCCCACTGG - Intergenic
1039973436 8:42339439-42339461 GATCAGGATCAGGATCCCACAGG - Intronic
1040804494 8:51378698-51378720 CAGCAAGACCAGGATCCCACTGG + Intronic
1045388634 8:101693585-101693607 CAGCAGCATCAGCATCACACCGG - Intronic
1048512439 8:135074998-135075020 CAGCAGCATCAGCATCCTACGGG + Intergenic
1049473537 8:142786753-142786775 CAGCAGGGCCAGGAGGCCACTGG - Intergenic
1050789078 9:9443263-9443285 CAGCATGGACAGGATCCCAAGGG + Intronic
1051125581 9:13800872-13800894 CAGCAGCATCAGCATCACCCCGG + Intergenic
1055115478 9:72600913-72600935 CAGCAGCCTCAGCATCCCCTGGG - Intronic
1056105994 9:83346847-83346869 CAGCAATGTCAGCATCCCCTGGG - Intronic
1057450880 9:95158783-95158805 CAGCAGCATCAACATCCCTCGGG - Intronic
1060873673 9:127064004-127064026 CAGCATGGTCAGCCTCCTCCTGG + Intronic
1061136235 9:128735566-128735588 CAGCTGGCCCTGCATCCCACTGG + Intronic
1061193264 9:129094386-129094408 CAGCAGGCTCAGCTTGCCCCAGG - Intergenic
1061376230 9:130226393-130226415 CTGCAGGGTCAGCTTCCCGTCGG - Exonic
1061967013 9:134020661-134020683 CAGCAAGGTGGCCATCCCACAGG + Intergenic
1062443027 9:136579510-136579532 CAGCAGGGTGAGCCTCCTGCAGG + Intergenic
1062518532 9:136947772-136947794 CAGGGGGGTCCCCATCCCACGGG + Intronic
1187288755 X:17931899-17931921 CAGCAGCATCAACATCCCCCGGG - Intergenic
1187701585 X:21968553-21968575 CAGCAGCATCAGCATCCCCCGGG - Intronic
1189078334 X:37941713-37941735 CAGCAGGATAAGCATCACATGGG - Intronic
1189203402 X:39217120-39217142 CAGCAGGGTCACATTCCCTCTGG - Intergenic
1190364071 X:49675403-49675425 CAGCAGGGTCATCTTACAACAGG - Intergenic
1192690114 X:73353858-73353880 CAGCAGGGACAGATTGCCACTGG + Intergenic
1198562909 X:137870824-137870846 CAGCAGGGTAAGCATCCTGAAGG - Intergenic
1199766358 X:150944485-150944507 CAGCAGCATCAGCATCACATGGG - Intergenic
1200690879 Y:6305854-6305876 CAGCAGGGTCAACTGCGCACAGG - Intergenic
1201044393 Y:9868862-9868884 CAGCAGGGTCAACTGCGCACAGG + Intergenic
1201685768 Y:16700740-16700762 CAGCAGCCTCAGCATCACATGGG - Intergenic