ID: 981941295 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:150284132-150284154 |
Sequence | CTGTAGATATGCAGCCAGGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
981941292_981941295 | -10 | Left | 981941292 | 4:150284119-150284141 | CCCTGCTGAGACACTGTAGATAT | 0: 1 1: 0 2: 0 3: 10 4: 122 |
||
Right | 981941295 | 4:150284132-150284154 | CTGTAGATATGCAGCCAGGAAGG | No data | ||||
981941291_981941295 | 5 | Left | 981941291 | 4:150284104-150284126 | CCTGTGGGATGCTGACCCTGCTG | 0: 1 1: 0 2: 1 3: 27 4: 314 |
||
Right | 981941295 | 4:150284132-150284154 | CTGTAGATATGCAGCCAGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
981941295 | Original CRISPR | CTGTAGATATGCAGCCAGGA AGG | Intronic | ||
No off target data available for this crispr |