ID: 981941295

View in Genome Browser
Species Human (GRCh38)
Location 4:150284132-150284154
Sequence CTGTAGATATGCAGCCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981941292_981941295 -10 Left 981941292 4:150284119-150284141 CCCTGCTGAGACACTGTAGATAT 0: 1
1: 0
2: 0
3: 10
4: 122
Right 981941295 4:150284132-150284154 CTGTAGATATGCAGCCAGGAAGG No data
981941291_981941295 5 Left 981941291 4:150284104-150284126 CCTGTGGGATGCTGACCCTGCTG 0: 1
1: 0
2: 1
3: 27
4: 314
Right 981941295 4:150284132-150284154 CTGTAGATATGCAGCCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981941295 Original CRISPR CTGTAGATATGCAGCCAGGA AGG Intronic
No off target data available for this crispr