ID: 981941791

View in Genome Browser
Species Human (GRCh38)
Location 4:150288813-150288835
Sequence TTAAGTTACCATTTCATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981941791 Original CRISPR TTAAGTTACCATTTCATGGA TGG Intronic
904939266 1:34153652-34153674 TTAAAGTACAATTTAATGGATGG - Intronic
907083046 1:51642615-51642637 CTAAGTGACCATTTCATGAGGGG - Intronic
907403336 1:54238951-54238973 CTCAGTTCCCATTTCATGGGCGG - Intronic
908164782 1:61447344-61447366 TTAAGTTACAAATTCATTAAAGG - Intronic
909732213 1:78907313-78907335 TTAAATTTCCATTTTAGGGAAGG + Intronic
909804253 1:79855128-79855150 CTAAGTTACAAGTTCTTGGAGGG + Intergenic
911870706 1:103094383-103094405 TTTAGTTACCATATCATAGAAGG - Intronic
912078817 1:105911043-105911065 TGAAGGTCCCATTTCATGGAAGG + Intergenic
913359036 1:117958566-117958588 TTAAGTTAGCATTTCTTAGAAGG + Intronic
917613203 1:176710966-176710988 TGAAGTCAGCATTTCAAGGAAGG + Intronic
918859487 1:189803909-189803931 TTAAGATACCATTTCATTTGGGG + Intergenic
919489272 1:198185618-198185640 TAAAGCTTACATTTCATGGATGG - Intronic
919547145 1:198938156-198938178 TTAATTTACCACTTTATGTAAGG + Intergenic
919563612 1:199156285-199156307 TCATGGTACCATTTTATGGAAGG + Intergenic
920902000 1:210118782-210118804 TTATCTTACCATTTGGTGGATGG + Intronic
921948517 1:220905798-220905820 TTAAATTACCAATTAATGGATGG - Intergenic
1065517170 10:26535634-26535656 AAAAGTTACCATTTCATTGCTGG - Intronic
1066326201 10:34361726-34361748 TAAAGTTAACATTTTATGGTAGG + Intronic
1067183698 10:44009385-44009407 TTAGGTTACCATTTCAAGACAGG - Intergenic
1067673082 10:48343849-48343871 TTCAGCTATCATTTCATGCATGG - Intronic
1068654480 10:59560591-59560613 CTAAGTTACTATTTCATGTACGG - Intergenic
1068993127 10:63171743-63171765 ATATGTTAGAATTTCATGGAGGG - Intronic
1069936222 10:71919082-71919104 TTAAATTCCCATTCCCTGGATGG + Intergenic
1071046066 10:81379250-81379272 TTAATTTACACTTTAATGGACGG - Intergenic
1072659936 10:97357484-97357506 GTAAGTTACCTTTCAATGGAGGG - Intronic
1073385205 10:103121488-103121510 TTAAGTGAACATTTTTTGGATGG - Intronic
1074009659 10:109465099-109465121 TTTAATTCCCATTTTATGGATGG + Intergenic
1074689843 10:115994388-115994410 TGAAGTTAACGTTTCATGCAAGG - Intergenic
1076512383 10:131021895-131021917 TGGTGTTAACATTTCATGGAAGG - Intergenic
1078196433 11:9140679-9140701 TTAAGTGAGCCTTTAATGGAAGG - Intronic
1079028228 11:16965760-16965782 TTTTGTTGCCATTTCATAGATGG - Intronic
1080276588 11:30509799-30509821 TTAGTTTCCCATTCCATGGAAGG - Intronic
1080426114 11:32155701-32155723 TTAAGCTATCAGTTCATGGAAGG + Intergenic
1081607323 11:44535542-44535564 AGCAGGTACCATTTCATGGAAGG - Intergenic
1083957783 11:65995497-65995519 TTAAGATACCACTTCTTGGGTGG + Intergenic
1086911821 11:92480844-92480866 TGAAGTTATGATTTCATGAATGG + Intronic
1087139764 11:94753899-94753921 TTAAGTTACCAGTTCTTTGAGGG - Intronic
1087995318 11:104799582-104799604 TCCAGTTCCCATTTTATGGATGG + Intergenic
1088760164 11:112922011-112922033 TTAGGTTACAATCTCAGGGAGGG + Intergenic
1089711737 11:120319833-120319855 TTAAGTTACCATTTCTGGAATGG - Exonic
1092794074 12:12093217-12093239 TTAAGTGAACATTGCATGCAAGG + Intronic
1093234998 12:16598931-16598953 TTATGTTACCATTTCAAATAAGG - Intronic
1093567810 12:20629255-20629277 TAAAGTTTCCATTTCAAGTATGG - Intronic
1095382114 12:41607442-41607464 TTAAATGACCATTAAATGGAAGG + Intergenic
1098374720 12:69802814-69802836 TTAGGTGACCATTTGTTGGAGGG + Intronic
1099581489 12:84452580-84452602 GTAAATAAGCATTTCATGGAGGG - Intergenic
1100427176 12:94498230-94498252 TTATGTAACCATGTTATGGATGG - Intergenic
1101195669 12:102379450-102379472 TTCCATTACCATTTCCTGGATGG - Intergenic
1101401123 12:104387997-104388019 TTACCTTACCATTTGATGAAGGG + Intergenic
1103512692 12:121486070-121486092 AAAAGTTACCATTTCAGGCAGGG - Intronic
1104880304 12:132066325-132066347 TTAAGTTACCATTTAAAAAATGG - Intronic
1105825521 13:24119216-24119238 TTATGTTCCCATTTTATAGAGGG + Intronic
1106855780 13:33851048-33851070 TTAATTTCTCATTCCATGGAGGG - Intronic
1106904794 13:34394111-34394133 TTTAGTTACCATTTATTGAATGG + Intergenic
1107704278 13:43084205-43084227 CTAACTTAACATTTCTTGGATGG - Intronic
1108450454 13:50557382-50557404 TTTAGTGCCCATATCATGGAAGG - Intronic
1108671709 13:52696946-52696968 TTGAGATACCATTTTTTGGAGGG + Intronic
1109232226 13:59771587-59771609 ATAAGTCACCAGCTCATGGATGG + Intronic
1110302843 13:73949607-73949629 TGAAGTTAGCGTTTCATTGAAGG - Intronic
1110578411 13:77088348-77088370 ATAACCTACCACTTCATGGATGG - Intronic
1111229350 13:85322237-85322259 TTAAATTACAGTTTCATGTAGGG - Intergenic
1111568195 13:90044230-90044252 TTAAGATACCATATCATGGCTGG + Intergenic
1112154658 13:96804176-96804198 TCAAGTTACCAAATCCTGGAAGG + Intronic
1116240820 14:42340333-42340355 TTAAGTTACTATTTCTTTGTGGG - Intergenic
1117015284 14:51511542-51511564 TTATGTCACCATTTTATAGAGGG + Intronic
1118922479 14:70162193-70162215 TGAAGTTAACATTTTATTGATGG + Intronic
1119694011 14:76698351-76698373 TTAAGATCCCATGTCATGGCAGG + Intergenic
1120443656 14:84566926-84566948 TTAGGTTTCCACTTCATGGAAGG - Intergenic
1121989325 14:98539946-98539968 CTGATTTGCCATTTCATGGAGGG + Intergenic
1122348860 14:101076457-101076479 TGAAGTTACCCCTCCATGGAAGG - Intergenic
1122933839 14:104946881-104946903 TTAAGATCCCCTTGCATGGAGGG + Exonic
1122933953 14:104947376-104947398 TTAAGGTCCCCTTGCATGGAGGG + Exonic
1124169215 15:27357936-27357958 TGAAGTTACAAATTCATGCATGG - Intronic
1125623745 15:41088578-41088600 TTTACTTACCACTTCCTGGATGG - Intronic
1126541638 15:49830703-49830725 TCAAGTTTTCATTCCATGGATGG - Intergenic
1127544124 15:59974294-59974316 TTTGGGTACCACTTCATGGAAGG - Intergenic
1128840506 15:70847065-70847087 TTAAATTCCCATTACATGCAAGG - Intronic
1130132524 15:81156122-81156144 TTAGGGTACAATTTCTTGGAGGG - Intergenic
1130206980 15:81886194-81886216 TTAAATTACTATTTCAAGGTGGG + Intergenic
1131962837 15:97807563-97807585 TTATTTTCCCATTTCAGGGATGG - Intergenic
1133659916 16:7906263-7906285 TTAAGTTAAAACTTAATGGATGG - Intergenic
1135513582 16:23110602-23110624 TTAATTTACCAGTTCATTTACGG - Intronic
1137493995 16:48955167-48955189 CTTAGTTCCCATTTCATGTATGG + Intergenic
1137780208 16:51091657-51091679 TTGTGTTTCTATTTCATGGATGG - Intergenic
1141785285 16:86195681-86195703 TTAATTTACGAATTCATCGAGGG - Intergenic
1141867220 16:86758816-86758838 GTAAGTTCCCACTTCTTGGAAGG - Intergenic
1142634525 17:1248620-1248642 TTAAGTTAACATATCATGGCTGG - Intergenic
1143878473 17:10011678-10011700 TTAAGATACCATCTCAAGGCCGG + Intronic
1149157229 17:53646855-53646877 TTAAGTTATGTTTTCCTGGATGG + Intergenic
1150959612 17:69899500-69899522 TTATATTACAATTTCATGGGAGG + Intergenic
1152845428 17:82596855-82596877 TTCAGGTTCCATTTCATGGTAGG + Intronic
1153486489 18:5603920-5603942 AAAAGTTAACATTTCCTGGAAGG + Intronic
1153659228 18:7311777-7311799 TTCAGTGCCCATATCATGGAAGG + Intergenic
1153959257 18:10126934-10126956 TACAGTTACCATGTCCTGGAGGG - Intergenic
1156565090 18:38178993-38179015 TTAAGATACCACTTGATGAATGG + Intergenic
1157646005 18:49272169-49272191 GTAACTTACCACTTCATGAATGG + Exonic
1158881553 18:61783886-61783908 TTAGGCTACCATTTCATCCATGG - Intergenic
1158965306 18:62617159-62617181 TTAAGTTACTAGTTCAGGTATGG - Intergenic
1160359670 18:78262889-78262911 TTATGTTACCATTTCTTGTAAGG - Intergenic
1162297481 19:9823335-9823357 TGTAGTTACCACTTCATGGTAGG - Intronic
1164247503 19:23445505-23445527 TTAAGTTAAAATGTCATAGATGG + Intergenic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1167421204 19:49404393-49404415 TTCAGGTCCCATTTCATGGCTGG + Intronic
925995324 2:9288110-9288132 TAAAGGTACCTTTTCCTGGAGGG - Intronic
933082012 2:78002279-78002301 TTAAGTAAAAATTTCATGGAAGG - Intergenic
933783712 2:85820908-85820930 TTATTTTAACATTTCTTGGAAGG - Intergenic
933974596 2:87498054-87498076 TTAAGTTCACATTTCATTGCTGG - Intergenic
935557338 2:104524456-104524478 TAGATTTACCATTTTATGGATGG - Intergenic
936319228 2:111452760-111452782 TTAAGTTCACATTTCATTGCTGG + Intergenic
937844888 2:126568885-126568907 TTAAATTTGCATTTCCTGGATGG - Intergenic
938214544 2:129499896-129499918 TTCATGTACCATTTCATGAAGGG - Intergenic
939730614 2:145780178-145780200 TTAATTTACTATTTCTTGTAGGG + Intergenic
939955066 2:148520895-148520917 TTAAGTGACCACTGCACGGAAGG - Intergenic
940050095 2:149453006-149453028 TTAAGCTCCCATTTCTAGGAAGG - Intronic
944320888 2:198340429-198340451 TTAAGTTACCCATTCTTGAAGGG + Intronic
948980213 2:241490702-241490724 TTAAGTGAGCATTTCCTGGTGGG - Intronic
1171411488 20:24951234-24951256 TTATCTTCCCATTTCATGGATGG - Intronic
1174401068 20:50276264-50276286 GTAAGTTCCCTTTTCATAGATGG - Intergenic
1176974279 21:15301198-15301220 TTAGGTTACCATGTCATGTGAGG - Intergenic
1181850427 22:25745836-25745858 TTGAGTTTCAATTTCATGGAGGG + Intronic
949477258 3:4459990-4460012 TTAATTTTCCATTTTATTGAAGG - Intronic
950352596 3:12371528-12371550 GTAAGGAACCATTTCCTGGATGG - Intronic
950785934 3:15435634-15435656 TTAACTAACCATTTCAAGAAAGG - Intronic
950836696 3:15926740-15926762 TAAAGTTCCCATTTCATGTATGG - Intergenic
951373736 3:21887187-21887209 TGAAGTGACTATTTCATGAAGGG + Intronic
951518275 3:23586151-23586173 TTAAGCTAATATTTCATGAAAGG - Intronic
955382571 3:58451672-58451694 TTTAGTGCCCATATCATGGAAGG + Intergenic
956548257 3:70431064-70431086 TTGAGTTATTATTTGATGGAAGG + Intergenic
957407128 3:79786366-79786388 TTGAATTACCATTTCATGCCAGG - Intergenic
959408001 3:105985116-105985138 TTATTTTACCATTTCAGGAAAGG - Intergenic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
961222174 3:125209920-125209942 TTAAGGTACCATTTCTTGATTGG - Intronic
963156353 3:142101282-142101304 TTCAGGAACCATCTCATGGAAGG + Intronic
965300592 3:167001117-167001139 TTAAATCTCCGTTTCATGGAAGG - Intergenic
966385496 3:179393380-179393402 TTATGTTTCCTTTTCATGGGAGG + Exonic
967327722 3:188258822-188258844 TGATGTTACCATTCCATTGAAGG + Intronic
967414198 3:189198631-189198653 TTAAGTTTAAATTTCTTGGATGG - Intronic
969997351 4:11326558-11326580 CGAAGTTACCTCTTCATGGAGGG + Intergenic
971881418 4:32379473-32379495 TGAAGTTACCATTTCCTGTCAGG - Intergenic
972703759 4:41519830-41519852 TTAAATCCCCATTTTATGGAAGG + Intronic
976067006 4:81199182-81199204 GTAAGTCAGTATTTCATGGAAGG + Intronic
981162470 4:141514925-141514947 TTTTCTTACCATTTCATGAAGGG - Intergenic
981941791 4:150288813-150288835 TTAAGTTACCATTTCATGGATGG + Intronic
984618306 4:181923625-181923647 TTAAACTACCATTTCATTAAGGG + Intergenic
985354759 4:189106627-189106649 CAAAGTAACCTTTTCATGGAAGG - Intergenic
986031490 5:3898077-3898099 TTATCCTACCATTTCATGAAAGG - Intergenic
986966801 5:13283181-13283203 TGTAATTACCATTGCATGGAAGG - Intergenic
989575519 5:42984240-42984262 TTAAGGTACAATTTTATGTAAGG + Intergenic
990397153 5:55393997-55394019 TTAGTTGACCATTTCTTGGATGG + Intronic
990499483 5:56381400-56381422 TCACTATACCATTTCATGGATGG - Intergenic
991416000 5:66393462-66393484 TTAAGTCACTATGTCTTGGATGG + Intergenic
992005301 5:72471550-72471572 CTGAGTTACCAATTTATGGAGGG + Intronic
993032376 5:82720302-82720324 GTAAGTTACTGTTTTATGGAAGG + Intergenic
993881801 5:93371633-93371655 TTATTTTACCATTTCATGAAAGG - Intergenic
994529649 5:100953165-100953187 TTACTGCACCATTTCATGGATGG + Intergenic
995327791 5:110911280-110911302 TTCAGTGCCCATATCATGGAAGG + Intergenic
996254091 5:121376807-121376829 TTAAGGTAATATTTCATGGTAGG + Intergenic
996517807 5:124392543-124392565 ATAGTTTTCCATTTCATGGATGG - Intergenic
998251375 5:140555653-140555675 ATAAGTCACCATTACAAGGATGG - Intronic
1002408198 5:179052917-179052939 TAAAGTTACCACTGCATGGGGGG + Intergenic
1002973268 6:2046941-2046963 TGAATTCACCATTTCATGTAAGG - Intronic
1003289064 6:4763186-4763208 TTATTTTACCTTTTTATGGAAGG - Intronic
1005724729 6:28637565-28637587 TTAACCTTCCATGTCATGGAAGG - Intergenic
1007143131 6:39597088-39597110 TTAATGCACCATTTCATAGATGG + Intronic
1008025998 6:46636602-46636624 TTCAGGTATAATTTCATGGAAGG + Intronic
1008646977 6:53524434-53524456 TTATGCTTTCATTTCATGGAAGG + Intronic
1009229188 6:61042817-61042839 TTAAGAAACCATATCATTGAGGG + Intergenic
1009773071 6:68169205-68169227 TTAAGTTCTCATTTCATTAATGG - Intergenic
1010581398 6:77601174-77601196 TTAATCTTCCATTTCATGAAGGG + Intergenic
1011064862 6:83314220-83314242 TTAAGTTAGCATTTGATTGTGGG - Intronic
1015770847 6:136766650-136766672 TTAAGGTAACATTTCAGAGAAGG + Intronic
1016353537 6:143193834-143193856 TTATTATCCCATTTCATGGAAGG + Intronic
1017375986 6:153768445-153768467 TTAAGGTACCATATAATGCATGG - Intergenic
1018384507 6:163290781-163290803 TTAAGTGACCATTGTGTGGAAGG - Intronic
1018952817 6:168390357-168390379 GGAAATTACCATTTCCTGGAGGG - Intergenic
1020841056 7:13218299-13218321 TTAAATAAACATTTTATGGATGG - Intergenic
1021507465 7:21401548-21401570 TCAGGTTACCATGTCATTGATGG + Intergenic
1022836930 7:34127007-34127029 CTTAGTTACTATTTCATGGTAGG + Intronic
1023281615 7:38576512-38576534 TTAACATACGATTTCCTGGAAGG - Intronic
1027528350 7:79299598-79299620 TTATATTACCATTTCAAGAAAGG - Intronic
1028090796 7:86698339-86698361 TTAAGTTACCTTTTAAGGAAGGG - Intronic
1031873390 7:127111444-127111466 TTCACTTACCATTTCAAGGAAGG - Intronic
1032917977 7:136512411-136512433 TTAAGTCCCCGCTTCATGGAAGG - Intergenic
1032959714 7:137017325-137017347 ATAAGTTAACATTTCATACATGG - Exonic
1033824803 7:145176372-145176394 TTAAAGCACCATTTTATGGAAGG - Intergenic
1035446410 7:158946099-158946121 TTAAGATACATTTTCATGGTAGG - Exonic
1035837832 8:2773728-2773750 ATAAATTACCATTCCATGCAAGG - Intergenic
1036165146 8:6425682-6425704 TTAAGTTAGCAGTTTAAGGAAGG - Intronic
1036570099 8:9972799-9972821 ATAATTTACCATTTCAGGGCTGG - Intergenic
1038673096 8:29597997-29598019 TTAAGTTGTCTTTTCCTGGAAGG + Intergenic
1042168254 8:65967585-65967607 TTAAGTTACCATTTGTCAGACGG - Intergenic
1042514134 8:69642094-69642116 TTAAGTTCACATTTCTTTGACGG - Intronic
1044361889 8:91295348-91295370 GTAAGTTTCCATTTCATCCATGG + Intronic
1051195102 9:14555644-14555666 TTCAGTTATCACTTCCTGGAGGG - Intergenic
1055824764 9:80310416-80310438 TGATGTTAGCATTTCATGTAAGG - Intergenic
1058007661 9:99935972-99935994 CTAAGTTACCATATCCTGCAAGG - Intronic
1058559322 9:106207813-106207835 CTAATTTACCATTTTTTGGAGGG + Intergenic
1059165342 9:112071870-112071892 TTAATTTACCATGCCTTGGATGG - Intronic
1059607125 9:115845614-115845636 TTAAGTTCCCAATTCAGGGCAGG + Intergenic
1061209601 9:129183137-129183159 TATAATTCCCATTTCATGGATGG + Intergenic
1061814119 9:133183059-133183081 TTTTGTTAACCTTTCATGGAAGG - Intergenic
1186434799 X:9533523-9533545 TTAAGTTTCTCTTTCATGGAGGG - Intronic
1186713424 X:12225226-12225248 TTAAGTAAACATTTGATGGAAGG + Intronic
1186753491 X:12645899-12645921 TTAAGCTTCCATTTGATGGCAGG + Intronic
1187506339 X:19881389-19881411 TTTACTTCCCATTTCATTGAGGG - Intronic
1187726122 X:22203992-22204014 TTAAGTCACCATCTCTGGGATGG - Intronic
1187966048 X:24613029-24613051 TAGACTTATCATTTCATGGATGG + Intronic
1189658723 X:43275805-43275827 TTAAATAAGCATTTCATAGAAGG + Intergenic
1193936833 X:87633537-87633559 TTTAGTTACTATATCATAGAAGG - Intronic
1194697104 X:97066572-97066594 TTAAGTTACCACTTCAAACAAGG + Intronic
1196573865 X:117295722-117295744 TTAAATGACCTCTTCATGGAAGG - Intergenic
1199386122 X:147225370-147225392 TTCAGTCACCAATTTATGGAGGG - Intergenic
1201270298 Y:12247513-12247535 TAAACTTACCACTGCATGGAGGG - Intergenic