ID: 981942862

View in Genome Browser
Species Human (GRCh38)
Location 4:150303874-150303896
Sequence CAAAGATTCTTAAAGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981942862_981942866 -8 Left 981942862 4:150303874-150303896 CCCTCACCCTTTAAGAATCTTTG 0: 1
1: 0
2: 3
3: 16
4: 221
Right 981942866 4:150303889-150303911 AATCTTTGTTTAACCAGATATGG 0: 1
1: 0
2: 2
3: 12
4: 208
981942862_981942867 -5 Left 981942862 4:150303874-150303896 CCCTCACCCTTTAAGAATCTTTG 0: 1
1: 0
2: 3
3: 16
4: 221
Right 981942867 4:150303892-150303914 CTTTGTTTAACCAGATATGGTGG 0: 1
1: 0
2: 0
3: 7
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981942862 Original CRISPR CAAAGATTCTTAAAGGGTGA GGG (reversed) Intronic
900894955 1:5476893-5476915 GGAAGATTCGTAAAGGGAGATGG - Intergenic
905919096 1:41707467-41707489 CAAAGTCTCTTAAAGGGCCAAGG + Intronic
905945848 1:41900948-41900970 CAAACATTCTGGAAGGGTCAAGG + Intronic
906566718 1:46806157-46806179 CAGGGATTCTTACTGGGTGAAGG + Intronic
907564249 1:55419950-55419972 CCAAGATTCATTAAGAGTGATGG - Intergenic
907836026 1:58109325-58109347 CAAAGATTCTTAACAGATGCAGG - Intronic
908750707 1:67420294-67420316 GAAAGATTATTCAAGGATGAGGG + Intronic
908926887 1:69266184-69266206 CAGAGAATCTTAAAGCTTGAAGG + Intergenic
910278691 1:85474823-85474845 CATAGATTCTTAAAGCTGGAAGG - Intronic
910379292 1:86608966-86608988 CAAGGACTCTTAGAAGGTGACGG + Intergenic
910583740 1:88856459-88856481 CACAGAATGTTAAAGGCTGATGG + Intronic
912004935 1:104886399-104886421 CCAAGATTCTTAAGGACTGAAGG + Intergenic
912018799 1:105077220-105077242 CAAGGATTTTTAAAAAGTGATGG - Intergenic
912040476 1:105383639-105383661 CTATGATTCATGAAGGGTGAGGG + Intergenic
913280564 1:117181436-117181458 CAGGGATTCCTAAAGGGAGAAGG - Intronic
915031023 1:152880635-152880657 CAAAGACTCCTAAAGGATGGGGG - Intronic
915800901 1:158792266-158792288 TAAAGATTCTTATAGGCTCAAGG - Intergenic
915832897 1:159147295-159147317 AAGAGATCCTTAAAGGGTCAAGG + Intergenic
916472494 1:165137803-165137825 CAAATATTCTTAAACGGACAGGG - Intergenic
917452651 1:175159982-175160004 CCAAGATGTTTAAAGTGTGATGG - Exonic
921352140 1:214246785-214246807 CAGAGAATCTTAAAGGGGAAAGG + Intergenic
921778439 1:219131034-219131056 CACAGATTATTAAAGAGTAAAGG + Intergenic
1063244523 10:4204469-4204491 CAAAGAAGCTGAAAGAGTGATGG - Intergenic
1063612321 10:7573188-7573210 CAAAGGTCCTAAAAGGGAGAAGG + Exonic
1064728633 10:18306694-18306716 CAAAGATAGTTAAGGAGTGAGGG + Intronic
1064795810 10:19010000-19010022 CAAAGTTTAGTAAATGGTGAAGG + Intergenic
1064799072 10:19048291-19048313 CATAGATTTTTAAAAGTTGAGGG - Intergenic
1066105774 10:32155509-32155531 CAAAGACTCTGAAAGGTGGAGGG - Intergenic
1068913693 10:62406002-62406024 CCAAGATTCTTAAAGGGTAAGGG + Intronic
1070371624 10:75787597-75787619 CAAAGATGTTTAAGGGGTAAGGG - Intronic
1070933130 10:80274698-80274720 CAAAGCTTCTGAAAGGGGCAGGG - Intronic
1071276092 10:84056607-84056629 GAAAGATTTTTAAAAGGAGAAGG + Intergenic
1072272030 10:93786126-93786148 CAAACCTCCCTAAAGGGTGAGGG + Intronic
1072946797 10:99817498-99817520 CAAGGGATCTTCAAGGGTGAAGG + Intronic
1073297052 10:102447118-102447140 CAATGATCATTAAGGGGTGAGGG + Intergenic
1076925665 10:133483455-133483477 AAAAGATTTTTACATGGTGAAGG - Intergenic
1084097206 11:66919440-66919462 AAAATATTCTTTAAGGGTGTGGG - Intronic
1085107055 11:73853992-73854014 GATAGCTTCTTAAAGGTTGATGG + Intronic
1085925242 11:81010735-81010757 CAAAGTTTTTTAAAGAATGATGG + Intergenic
1088177443 11:107069764-107069786 TAAACTTTCTTAAAGGGTGATGG - Intergenic
1090535064 11:127631974-127631996 CATAGCTTCTTTAATGGTGAAGG - Intergenic
1090959204 11:131540872-131540894 GAAAGACTCTTAAAGGGGCAGGG - Intronic
1091067473 11:132529652-132529674 CAAAGATTTTAAAAGGGTCTGGG - Intronic
1091161763 11:133429156-133429178 CAAAGATTTTAAAAAGATGAAGG + Intronic
1091842111 12:3628643-3628665 CAAACATTCTTACAGGATGCAGG - Intronic
1092758451 12:11787035-11787057 CAAAGAGTCTGAAAGAGTAATGG + Intronic
1093033904 12:14315041-14315063 TGAAAATCCTTAAAGGGTGAGGG + Intergenic
1093286829 12:17274271-17274293 CAATGATTTTTAAAAGGTAAAGG + Intergenic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1098166995 12:67709027-67709049 AAAACAATCTTATAGGGTGATGG + Intergenic
1098195954 12:68002479-68002501 CAAAGATTTTTAAAAGGGTAAGG - Intergenic
1099086242 12:78249633-78249655 CAAAGGTTCTTAAATGGTTTTGG - Intergenic
1099934188 12:89106047-89106069 CAAACATTCTTCAAGGTTTATGG - Intergenic
1100037309 12:90268477-90268499 CAAAGGTTCTTATAGAGTGAAGG - Intergenic
1100657569 12:96662810-96662832 CAAAGATTGGGAAAAGGTGAGGG - Intronic
1101022920 12:100572255-100572277 CTAAGAGTCTTGAAGGGTGATGG - Intergenic
1102013488 12:109633047-109633069 CATAAATGCTTAAAGGGTGCAGG + Intergenic
1102721459 12:115020180-115020202 GGAAGATTCTTAAAGGCTGGGGG + Intergenic
1103257963 12:119559246-119559268 CAGAGTTTCTGCAAGGGTGATGG - Intergenic
1104425725 12:128676519-128676541 CAATGATTCTCTAAGGGTGATGG - Intronic
1109165891 13:59034671-59034693 CTAAGAATCTTTATGGGTGATGG - Intergenic
1109203672 13:59458401-59458423 TAAAGATTCTTAAAAGATGCTGG + Intergenic
1110035305 13:70674722-70674744 TAAATATTCTTAAACTGTGAAGG + Intergenic
1110243112 13:73290450-73290472 GAAAGATTTTTTAAGGCTGAGGG - Intergenic
1111212699 13:85100357-85100379 CAATGAATCATAAAGGATGACGG + Intergenic
1112359908 13:98708075-98708097 CAAAGATATTAAAAGGGTGGGGG + Intronic
1112827128 13:103404559-103404581 CAAACATTCTTAATGAGTAAAGG + Intergenic
1113019461 13:105867630-105867652 TAAAGATTAGTAAAGGGTGGAGG - Intergenic
1115719089 14:36139993-36140015 CATGGATTCTTGGAGGGTGATGG - Intergenic
1116903376 14:50382497-50382519 GAAACATTCTTAAAGGGGCAAGG - Intronic
1116956476 14:50928711-50928733 GGAAGATTTTTAAAGGTTGATGG - Intronic
1118442312 14:65822893-65822915 CAAAGATTTTTAAAGCGTGAGGG - Intergenic
1118874144 14:69768217-69768239 GAAAGATTCTTCAAGGGATATGG + Exonic
1119139093 14:72249021-72249043 TAAAAATTCTTGAAGAGTGAAGG - Intronic
1119826354 14:77660314-77660336 CAAAGATTTGTAAAGGAAGACGG + Intergenic
1120378439 14:83741114-83741136 CAAAGATTATTAAAGTAAGAAGG + Intergenic
1120827556 14:88969319-88969341 CAAGGGTTCTTATAAGGTGAAGG + Intergenic
1122828098 14:104381950-104381972 AAACCATTCTTAAAGAGTGAAGG + Intergenic
1123842869 15:24267129-24267151 TAAAGATTCTGAAAGGAGGAGGG - Intergenic
1123857906 15:24433155-24433177 TAAAGATTCTGAAAGGAGGAGGG - Intergenic
1123862539 15:24483700-24483722 TAAAGATTCTGAAAGGAGGAGGG - Intergenic
1124033353 15:26031321-26031343 CAAAGAACCTAGAAGGGTGAAGG - Intergenic
1125008222 15:34841406-34841428 CCAACATACTCAAAGGGTGAGGG - Intergenic
1128190320 15:65687602-65687624 AAAATATTCTTCATGGGTGAAGG - Intronic
1129546729 15:76403802-76403824 CAACGATTCTTACTTGGTGAGGG + Intronic
1132039659 15:98514250-98514272 CACAGTTTCTTAAAGGGGAAAGG + Intronic
1132351578 15:101142742-101142764 CATAGACTCTTAGAGGGAGAGGG - Intergenic
1133689451 16:8199156-8199178 CAACGATTCATAAAGGGACAGGG + Intergenic
1133882694 16:9797929-9797951 CAGTGGTTCTCAAAGGGTGAAGG - Intronic
1133892521 16:9894077-9894099 CAGGGAATCTTAATGGGTGAAGG + Intronic
1134371597 16:13631159-13631181 CTAAGATTCTTAAATAATGAGGG - Intergenic
1134473211 16:14547140-14547162 GAAAAATTCTCAAATGGTGAAGG + Intronic
1135846429 16:25922845-25922867 CAACGGTTCTTAAAGGTTGATGG - Intronic
1136595055 16:31242574-31242596 AAAAGATGGTTTAAGGGTGAAGG - Intergenic
1139170320 16:64623370-64623392 TAAAGATTCTTATAGGTTTAAGG - Intergenic
1139446933 16:67003837-67003859 CAAAGATTTTCAAGAGGTGAAGG + Intronic
1139514386 16:67444796-67444818 CATACATTGTTAAGGGGTGATGG - Intronic
1146628499 17:34453174-34453196 CAAAGAGTCTGGAAGTGTGAGGG - Intergenic
1148815412 17:50324384-50324406 CAGTGAATCTTAGAGGGTGAGGG + Intergenic
1151134134 17:71929030-71929052 CATAGATGCTAAAAGGGGGATGG - Intergenic
1152201907 17:78952289-78952311 CACAGATTCTTAAAGGGCCGAGG + Intergenic
1152808250 17:82368525-82368547 AAAAATTTTTTAAAGGGTGAAGG - Intergenic
1152995191 18:399922-399944 CAACGCTTGTTAAAGGGTGGTGG + Intronic
1155709192 18:28854836-28854858 CAAATTTTTTTAAAGGGGGAGGG - Intergenic
1157498711 18:48174226-48174248 AAAAGATTCTTAAAAATTGAGGG + Intronic
1159233437 18:65639194-65639216 CAAAGATTCTGAAAGTGCTATGG + Intergenic
1159236258 18:65677479-65677501 CAAAGAGACTTAATTGGTGATGG - Intergenic
1160432929 18:78824696-78824718 CAAAGGTGCTTTAAGGGTGCGGG + Intergenic
1163845568 19:19636614-19636636 CAAAGATAGTTAAAGATTGAGGG + Intronic
1165730223 19:38140448-38140470 CAAAGAATCTTAAAGGCAGCTGG - Intronic
926114931 2:10206884-10206906 AAAAGATTCTTGAAGGATGAGGG + Intronic
926799058 2:16642798-16642820 CAAAAACTATTAAAAGGTGAAGG - Intronic
927085588 2:19671684-19671706 CAAAGAGTCTTTCAGGTTGATGG - Intergenic
928532013 2:32202154-32202176 TAAAGCTTCTGAAAGGTTGAGGG + Intronic
929266207 2:39921292-39921314 AAAAGATTCTTTAAGAATGAAGG - Intergenic
929360036 2:41076895-41076917 CCAGAATTCTTAAAGGGTAATGG + Intergenic
930145650 2:48000925-48000947 TAAAGATTCTTACAGGCTCAAGG + Intergenic
930412891 2:51049013-51049035 GAAAGTCTCTTAAAGGGTGCTGG - Intergenic
930772542 2:55142283-55142305 AAAAGATTCTTAAAAGAAGAAGG + Intergenic
931528304 2:63183995-63184017 TAAAGATTCTTATAGCCTGAAGG - Intronic
933244337 2:79958424-79958446 CAAAGGTCCTTAAAGGAGGAGGG + Intronic
934850313 2:97695546-97695568 CAATGATTATTCAGGGGTGAAGG - Intergenic
935380234 2:102444397-102444419 CATAGATTATCAATGGGTGATGG - Intronic
936893885 2:117405010-117405032 AAAAGACACTGAAAGGGTGAAGG + Intergenic
937349145 2:121149429-121149451 GAAAAGTTTTTAAAGGGTGATGG + Intergenic
938639648 2:133266001-133266023 CAGAGACTCCTAAAGGGTGGGGG - Intronic
939159580 2:138570971-138570993 GAAAGATTCTTACCTGGTGATGG + Exonic
940117872 2:150229340-150229362 CAAAGAATTTTAGAAGGTGAAGG - Intergenic
942511027 2:176701118-176701140 AAAATATTCTTCAAGAGTGACGG - Intergenic
942589309 2:177524105-177524127 CAAACGTTTTTAAAGGATGATGG + Intronic
942853399 2:180517906-180517928 CTAATATTCTTAAAAGGAGAAGG + Intergenic
946536654 2:220637075-220637097 CAAAGTTTTGAAAAGGGTGAAGG + Intergenic
947212390 2:227719868-227719890 GAAATTTTCTTAAAGGCTGAAGG + Intergenic
948290588 2:236821296-236821318 GAAAGATTCTGAGAAGGTGAGGG + Intergenic
1173936324 20:46868968-46868990 AAAATATTCTTCAAGGGAGAAGG - Intergenic
1173939383 20:46896548-46896570 CAAAGATATGTAAAGGATGAAGG - Intronic
1174851232 20:53997116-53997138 CAAAGATTTTTAAAAGGGCAAGG - Intronic
1175347848 20:58295030-58295052 CAAAGATTTTTAAGAGGAGAAGG - Intergenic
1176728657 21:10467164-10467186 CCAAGACTCTGAAAGGTTGAGGG - Intergenic
1176973773 21:15294863-15294885 CAAAGTTACTTAGAAGGTGATGG + Intergenic
1178512724 21:33219287-33219309 CAAAAAGTCTTTAGGGGTGATGG - Intergenic
1179129836 21:38625094-38625116 AAAAAATTCTCAAAGGATGAAGG - Intronic
1180301480 22:11039915-11039937 CACATTTTCTTTAAGGGTGAAGG - Intergenic
1182562154 22:31168901-31168923 AAAAAATTTTTAAAGGGTGGTGG - Intronic
950942079 3:16902942-16902964 CAAAGATTAATGAAGGTTGAGGG - Intronic
952212856 3:31246992-31247014 CAGGGATTCTCAAAGGGAGAGGG + Intergenic
957643101 3:82884628-82884650 CACAGATTCTTCAAGAGTGAAGG - Intergenic
957768764 3:84660405-84660427 AAAACATTCTTAAAGGGGGTGGG - Intergenic
957843921 3:85705850-85705872 CAAAAAATATTAAACGGTGAGGG - Intronic
958009768 3:87862225-87862247 AAAATGTTCTTAAAGAGTGAAGG - Intergenic
958143470 3:89593102-89593124 CCAATATTCTGAAAGGCTGAGGG + Intergenic
961622357 3:128234441-128234463 CAAAGATGACTCAAGGGTGATGG - Intronic
963849917 3:150200978-150201000 CAAAGAACCTGAAAAGGTGAAGG + Intergenic
967572886 3:191051738-191051760 CAAAGATTGTTATAGGTAGAAGG - Intergenic
967648119 3:191951664-191951686 TTAAAATTCTTAAAGGGTGAGGG - Intergenic
971525759 4:27616337-27616359 CAAGGATTCTTATGGAGTGATGG - Intergenic
971771603 4:30904424-30904446 CAAAGTTTCTTAAAAGGAGATGG - Intronic
971841214 4:31855011-31855033 AAATGATGCTTAAAGGGTAAAGG + Intergenic
974572956 4:63678532-63678554 CAATGCTTCTTAAATGCTGAAGG + Intergenic
976493046 4:85693784-85693806 TAGAGATTCTTAGAGGGAGATGG + Intronic
979815939 4:125104084-125104106 CAAACATTTTTACAGGGAGATGG + Intergenic
980327919 4:131372192-131372214 CAGAGATTCTAACAGAGTGAAGG - Intergenic
980801762 4:137760426-137760448 CAGTGACTCTTATAGGGTGATGG - Intergenic
980828385 4:138099693-138099715 CAAAGACTCTTAAAAGCTCAAGG + Intergenic
981942862 4:150303874-150303896 CAAAGATTCTTAAAGGGTGAGGG - Intronic
983570319 4:169200690-169200712 GAAAGATTTTTAAATGGTAAAGG - Intronic
983941731 4:173540035-173540057 CAAAAACTTTTAAAGCGTGAAGG - Intergenic
989271996 5:39544593-39544615 CAAAGCTTCTTAAGAGGTGATGG + Intergenic
989495375 5:42105686-42105708 CAATGATTCTTACAGGTTAAAGG - Intergenic
989557031 5:42809191-42809213 CAAAGAGTCTTAAATGGTAGAGG - Intronic
990503498 5:56421808-56421830 CAAAGATTTTTATAAAGTGAGGG + Intergenic
991915787 5:71604055-71604077 CATAAATTCTTAAAGAGTTAAGG - Intronic
992255642 5:74918129-74918151 CAAAGATCCTTAAAAGATAATGG - Intergenic
995036509 5:107540050-107540072 AAAGGATTCTAAGAGGGTGAAGG + Intronic
996166118 5:120226008-120226030 CAAACATTTTTAAAGGGAAAGGG - Intergenic
997995820 5:138585655-138585677 GATAGATTCTTTGAGGGTGAAGG - Intergenic
999453122 5:151693486-151693508 CAAGGGTTCTTAAAAGTTGAAGG - Intergenic
1001197040 5:169682776-169682798 CAAAGAAACTTTTAGGGTGATGG - Intronic
1001546326 5:172572732-172572754 CATAGATTCTGCCAGGGTGAGGG + Intergenic
1001735110 5:173990950-173990972 AAAATATTCTAAAATGGTGATGG - Intronic
1001788381 5:174433462-174433484 CCAAGATTCTCAAAGGAAGAAGG - Intergenic
1002907254 6:1459430-1459452 CAAAGCTTCTAAAAGGCTTATGG + Intergenic
1003721878 6:8712210-8712232 TAACAATTCTTAAAGTGTGAAGG - Intergenic
1003764650 6:9221227-9221249 CAAAGATTTTAACATGGTGATGG + Intergenic
1004443532 6:15676197-15676219 CAAAGACAGTTAAAGGGTGATGG - Intergenic
1005137156 6:22582824-22582846 CTAAGATTCATGAAGGCTGAAGG + Intergenic
1008697824 6:54061949-54061971 CAAAGACTTTTAAAGGGCAATGG - Intronic
1008925433 6:56887225-56887247 CAAAGAATGTTAAAGCTTGAGGG - Intronic
1010516624 6:76780772-76780794 CAGAGATTCTACAAGGGTGGAGG + Intergenic
1010720861 6:79281988-79282010 CAAAGAATCTAGAAGGGTGGAGG - Intergenic
1011355345 6:86467620-86467642 CAAAGAATCTAGAAGGGTGGAGG - Intergenic
1011828692 6:91341985-91342007 CAGAGAATCTTAAAGGGTGAAGG - Intergenic
1012970824 6:105728520-105728542 TAAAGATTCTTAAGAGATGAGGG - Intergenic
1014725828 6:124970782-124970804 CAAAGAGTCTAAAAGGGAGTGGG + Intronic
1016548558 6:145251465-145251487 CAAAGATTATTAGAAGCTGAGGG - Intergenic
1016911008 6:149199085-149199107 CATAGATCCTTAAAGAGAGATGG - Intergenic
1018274572 6:162117149-162117171 AAAAGCTTCTTAAAGTGGGAAGG + Intronic
1018355908 6:163016269-163016291 AAAAGATTTTTAAAGAGGGATGG + Intronic
1019192271 6:170259141-170259163 CAACGATTCTAAAAGGCTGGTGG - Intergenic
1023264590 7:38392303-38392325 GACAGAGTCTTGAAGGGTGAGGG + Intronic
1023328516 7:39086679-39086701 CAAAGATTCCTAAAAGGTCTTGG - Intronic
1031873395 7:127111475-127111497 AAAGGATCCTTAAAGGGAGAAGG + Intronic
1032366249 7:131302747-131302769 TTAAAATTCTGAAAGGGTGAAGG + Intronic
1033914103 7:146302518-146302540 CAAAGATTCTTCAAGATTTATGG + Intronic
1035486236 7:159228325-159228347 CAAAGATCCTACAAGGGTGGTGG - Intergenic
1038049966 8:23799237-23799259 CAAAGCTCCTTAAAGTCTGACGG + Intergenic
1038505541 8:28081571-28081593 CGAAGATTCTTTAAGGAAGATGG - Intronic
1038947841 8:32380874-32380896 CAAATACTTTTAAAAGGTGATGG - Intronic
1042373186 8:68016776-68016798 CAAAGATTTTTAAAGTTTGCTGG - Intronic
1043035780 8:75197118-75197140 CAAGTATTCTGAAAGGTTGAAGG + Intergenic
1044233731 8:89807186-89807208 CAAGTGTTCTTAAAGAGTGAGGG + Intergenic
1044374550 8:91454133-91454155 CAAATACTCTTAAGGGGTGTAGG - Intergenic
1044602711 8:94021577-94021599 GAAACATTTTTAAATGGTGATGG + Intergenic
1045841260 8:106584485-106584507 AAAAGATTCTTAAATCATGAGGG + Intronic
1046859551 8:119075079-119075101 AAAAGTTTCTTAAAGGAAGAAGG - Intronic
1048481647 8:134801445-134801467 CAAAGATTTTTAAAGTTTGCTGG - Intergenic
1048541367 8:135344926-135344948 CAATGATTCTCAAGAGGTGAAGG - Intergenic
1051153117 9:14107074-14107096 AACAGATTTTTAAGGGGTGAAGG + Intronic
1051297731 9:15614666-15614688 CAAATAATGTTAAAGGGGGAGGG - Intronic
1051384136 9:16488783-16488805 AAAACAGTCTTAAAAGGTGATGG + Intronic
1051729667 9:20127260-20127282 CAAACATTCTGAAAGAGGGAGGG + Intergenic
1052519668 9:29530534-29530556 CAAATATGCTTAAAGGGTAAAGG - Intergenic
1055311633 9:74988751-74988773 CTTACATTCTTAAAGGGTAATGG - Intronic
1056298751 9:85220506-85220528 GCAAGATTCTTAAAGTGTGGTGG + Intergenic
1056344593 9:85678554-85678576 TAAAAATTCTTAAAGGCAGAAGG - Intronic
1056649832 9:88449194-88449216 CAAAGGCTTTTAAAGGCTGAAGG - Intronic
1058758087 9:108102358-108102380 CCAAGATTGTTAAATGGGGAGGG + Intergenic
1059201288 9:112419506-112419528 AAAAGATTCTTAAAGTGTTCCGG - Intronic
1059867758 9:118535675-118535697 CAAAGATCCTTAAAGGAGGAAGG - Intergenic
1061896208 9:133649577-133649599 CAAAGGTTCCTCAAGGCTGAAGG + Intronic
1186598915 X:11015283-11015305 AAAAGAATCTTAAAAGGTGAGGG + Intergenic
1187772246 X:22713052-22713074 AAATGATTTTAAAAGGGTGATGG + Intergenic
1190068310 X:47258526-47258548 TAAAGATTCAGAAATGGTGAGGG - Intergenic
1190497383 X:51039795-51039817 TTAAGATACTTAAAGAGTGATGG - Intergenic
1193665955 X:84316946-84316968 TAATGATTCTTACTGGGTGATGG + Intergenic
1194053542 X:89101930-89101952 TAAATATTCTTAAAAGGTGAAGG - Intergenic
1194564314 X:95464845-95464867 AAAACAATCTTATAGGGTGATGG + Intergenic
1196775725 X:119335144-119335166 CAAAGATTTGTAAAAGGTGCTGG - Intergenic
1197330037 X:125142406-125142428 CAGAGGTTCTTGAAGGGTCACGG + Intergenic
1198881807 X:141289820-141289842 CAAAGAATCCTAAAGAGAGAAGG + Intergenic
1201588945 Y:15592399-15592421 CAATTATTTTTTAAGGGTGAGGG - Intergenic