ID: 981945567

View in Genome Browser
Species Human (GRCh38)
Location 4:150339616-150339638
Sequence TATGGACCCCAAAATGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981945567 Original CRISPR TATGGACCCCAAAATGTTCA TGG (reversed) Intronic
900330241 1:2130576-2130598 TATGAAGCCCAAAATCTACAGGG + Intronic
901536623 1:9886647-9886669 GATGGAACCCAGATTGTTCAAGG + Intronic
906169081 1:43708266-43708288 AAAGGAATCCAAAATGTTCATGG - Intronic
909124361 1:71647114-71647136 TATTGGCCCTAAAGTGTTCAGGG + Intronic
909709842 1:78635794-78635816 TATGTAACCCAAAAAGTGCAAGG - Intronic
910426343 1:87123140-87123162 TTTGGACCCCAAAATGTATCAGG + Intronic
917156545 1:172005990-172006012 TATTGACCACAAAATGTCCTGGG - Intronic
917632059 1:176900043-176900065 TATTCACTCCAATATGTTCATGG - Intronic
920869143 1:209779015-209779037 TATGGACACAGATATGTTCATGG - Intronic
924683137 1:246258669-246258691 TATAGTCACCAAACTGTTCAAGG - Intronic
1063170439 10:3505067-3505089 TATGGTCCCAAAAATATTCTTGG + Intergenic
1068919561 10:62468327-62468349 AAGGGACATCAAAATGTTCATGG + Intronic
1068990772 10:63148052-63148074 TATGTAACCCAAAATGGTCATGG + Intronic
1069108513 10:64413590-64413612 TATGTACTGCAAAATTTTCAAGG + Intergenic
1069779270 10:70944598-70944620 GATGCACCCCAAGATATTCAGGG - Intergenic
1071140906 10:82508338-82508360 TGTTGACACCAAAATGCTCAGGG + Intronic
1072472703 10:95728122-95728144 TATAGCCCCCACATTGTTCAAGG - Intronic
1073774446 10:106770192-106770214 TATGTACCAAAAAATGTTGAAGG + Intronic
1077704308 11:4469373-4469395 TATGTACCAGCAAATGTTCATGG + Intergenic
1078933539 11:15931542-15931564 TATGGAGCTAAAAATGTACAAGG + Intergenic
1083603859 11:63965273-63965295 GATGGATCCCACAATGTTGAGGG - Intergenic
1090455127 11:126842487-126842509 GATGAACCCCAATATGGTCATGG - Intronic
1090487183 11:127123960-127123982 TAGGGAGCCCAAATAGTTCATGG - Intergenic
1090899039 11:131009287-131009309 GATGGTCACCAAAATGTTAATGG - Intergenic
1091366499 11:135025335-135025357 AATGCACCCCAATATCTTCAAGG + Intergenic
1093927167 12:24920585-24920607 TCTGGACCCCAAAATATATAGGG + Intronic
1095557316 12:43523116-43523138 TTTGGTCCCCAAAATGTGCAAGG + Intronic
1098378952 12:69847534-69847556 GATGGAATCCAAAATGTTAATGG - Intronic
1100775328 12:97967076-97967098 CATGGACTCCAAAATGATCAGGG - Intergenic
1101040105 12:100746977-100746999 TATTCAGCCCAAAATGTCCACGG - Intronic
1101672573 12:106889852-106889874 TATGGAGAACAAACTGTTCAAGG + Intergenic
1103013725 12:117477845-117477867 TATCTACCCAAAGATGTTCATGG - Intronic
1106665706 13:31848111-31848133 TATGGACCACAAAATGGCCTTGG - Intergenic
1110520128 13:76465843-76465865 TATGTACCAGAAAATGTTCTAGG + Intergenic
1111843978 13:93486313-93486335 TATGTAGCTCCAAATGTTCATGG + Intronic
1115767863 14:36642558-36642580 TAGGTACCCCAAAATGTTGTTGG - Intergenic
1119271201 14:73306864-73306886 TATGGACCACAAATTATTCTAGG + Intronic
1120211439 14:81637659-81637681 TATGTACCCCACAATGTTCTGGG - Intergenic
1120283532 14:82468516-82468538 TATGGAACCCAAAAAGCCCAAGG + Intergenic
1120284789 14:82485999-82486021 TATGGGCCCAAAGATGATCAGGG + Intergenic
1120359420 14:83478727-83478749 TATGGACCACAAGATATTGAAGG - Intergenic
1120525467 14:85571948-85571970 TCTGGACCCCAAAATATTTGGGG - Intronic
1120702314 14:87711690-87711712 TATGAACACCAGAATGTTCAAGG + Intergenic
1124085411 15:26545548-26545570 GAGGGACCCCAAAATGTAAATGG - Exonic
1124480656 15:30076318-30076340 TATGGACTCCAAGATGCTCCAGG - Intergenic
1125117688 15:36114359-36114381 TTAGTACTCCAAAATGTTCAAGG - Intergenic
1126316256 15:47373169-47373191 TATGGAGCCCATAATATCCAGGG + Intronic
1128220015 15:65962493-65962515 TACCCAGCCCAAAATGTTCATGG + Intronic
1131789309 15:95947216-95947238 CAGGGACACCTAAATGTTCATGG - Intergenic
1137551733 16:49441889-49441911 TATAGACCCCACACTGTTTATGG - Intergenic
1142168401 16:88606127-88606149 TAGGGAACCCAAAATGTTAATGG - Intronic
1143874738 17:9983082-9983104 TATGGATACCAAAATGTTGATGG - Intronic
1144198483 17:12917981-12918003 TATGGACCTGAAACTATTCAAGG + Intronic
1144213320 17:13033459-13033481 TCTGGACTCCAGAAAGTTCAAGG + Intergenic
1144513167 17:15894978-15895000 TAGCGACTCCAAAATCTTCAGGG + Intergenic
1144763139 17:17718583-17718605 TATGGAACCCACCATGTTCCAGG - Intronic
1149165958 17:53752272-53752294 TCTAACCCCCAAAATGTTCAAGG + Intergenic
1150783730 17:68145142-68145164 TATAGAGTCCAAAATGTTGATGG - Intergenic
1150886836 17:69097063-69097085 AGTGGACCTCATAATGTTCAAGG + Intronic
1150938497 17:69663284-69663306 TCTGGACCCCCAAAGGTCCAAGG + Intergenic
1153513458 18:5880424-5880446 TTTAGACCACAAAGTGTTCAAGG - Intergenic
1153694836 18:7629841-7629863 AATGGACTTAAAAATGTTCATGG + Intronic
1156785401 18:40906947-40906969 TATGTACCGCATAATATTCAGGG - Intergenic
1157266319 18:46226093-46226115 TAATGACACAAAAATGTTCATGG - Intronic
1158564643 18:58544365-58544387 TGTGCACCCCAGGATGTTCAAGG + Intronic
1159315528 18:66768528-66768550 TATGGACCTCAGTATATTCATGG - Intergenic
1160392355 18:78543814-78543836 GATAGACGCCAAAATGCTCACGG - Intergenic
1165076721 19:33283442-33283464 CTTGGACCCCAAGCTGTTCATGG - Intergenic
1166640458 19:44490443-44490465 TTTTGACCCCAAACTGTTAATGG + Intronic
926708980 2:15860686-15860708 TAAGTACCCCAAAATCTGCAAGG - Intergenic
929858763 2:45657525-45657547 TATAGCCCCCAAAATGAGCATGG + Intronic
933050821 2:77599708-77599730 TCTGTACACTAAAATGTTCACGG - Intergenic
936674845 2:114702934-114702956 AGTGGACTCCAAATTGTTCAAGG - Intronic
936868011 2:117099176-117099198 TATGGATACCTAAATGCTCAAGG - Intergenic
941490314 2:166135797-166135819 CATGGGCCCCAAAATTTCCAAGG - Intergenic
942334052 2:174861911-174861933 TATTTATCCAAAAATGTTCATGG - Intronic
944112909 2:196153668-196153690 TATGCACACCAAAATTTCCAGGG - Intronic
1170421527 20:16198242-16198264 TATCAATCCCAAAAAGTTCAAGG - Intergenic
1171851868 20:30314530-30314552 TAAGGACCCAAAGATGATCAGGG - Intergenic
1175711381 20:61224100-61224122 TCTGAACTCCAAAAAGTTCAAGG - Intergenic
1177626715 21:23671809-23671831 TATAGCACACAAAATGTTCAAGG + Intergenic
1180833597 22:18918884-18918906 TTTGGGCCCCAAACTGCTCAGGG - Intronic
1181066231 22:20307370-20307392 TGTGGGCCCCAAACTGCTCAGGG + Intergenic
1183252514 22:36740144-36740166 TTTGGACCATAAAATCTTCATGG - Intergenic
1184401757 22:44278632-44278654 TCTGTACCCCCAAAGGTTCAGGG - Intronic
1203283682 22_KI270734v1_random:144182-144204 TTTGGGCCCCAAACTGCTCAGGG - Intergenic
952413081 3:33066499-33066521 TATGGAGGCCAAGAAGTTCAAGG - Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
957721076 3:84000228-84000250 TATGGAGGCCAAGATGTCCAAGG + Intergenic
958584875 3:96074191-96074213 TAAAGACACCAAAATGTTGAAGG + Intergenic
960188005 3:114667989-114668011 TATGTAACACAAAATTTTCATGG - Intronic
960833390 3:121876700-121876722 TATGTATCCTAAAATGTTAAGGG + Intronic
961718506 3:128875810-128875832 TTTTGACACCAAAATGTGCAAGG - Intergenic
963395370 3:144725578-144725600 TAAGGAACCCCAAATGTTTAAGG - Intergenic
967770050 3:193324875-193324897 TCTGGACCTCAAAATGTTTGAGG - Exonic
967826829 3:193883700-193883722 TCTGGACTCCAAAAGGTCCAAGG - Intergenic
968951786 4:3699185-3699207 AAATAACCCCAAAATGTTCATGG + Intergenic
970409011 4:15789867-15789889 TATGGAGGCCAAAAAGTCCAAGG - Intronic
973537030 4:51893825-51893847 AATGGACCTGAAAATGTTGATGG - Intronic
978137094 4:105275596-105275618 TATGGAAACCAAAATATGCAGGG + Exonic
980291717 4:130853366-130853388 AATTGGCTCCAAAATGTTCAGGG - Intergenic
981945567 4:150339616-150339638 TATGGACCCCAAAATGTTCATGG - Intronic
982399432 4:154950262-154950284 TATGAATGACAAAATGTTCAGGG + Intergenic
983069238 4:163249548-163249570 TATGGAACAGAAAATGTTTAGGG + Intergenic
984211621 4:176856545-176856567 CAAGGGCCCCAAAATGGTCAAGG - Intergenic
984466846 4:180110530-180110552 TATGGACCCCACACTGTGAAGGG - Intergenic
984782931 4:183542177-183542199 TCAGGACCCCAAACTCTTCATGG - Intergenic
985327467 4:188787594-188787616 TATGTAACCTAACATGTTCAAGG + Intergenic
985646443 5:1086915-1086937 GATGGTCCCCAAAATATACATGG + Exonic
986424724 5:7619748-7619770 TAGGGAAGCCAAAATCTTCATGG + Intronic
987600979 5:20069881-20069903 TATTGACACCGAAATGATCACGG + Intronic
987904792 5:24061621-24061643 TATTGTCCCTAAAATGTTAATGG + Intronic
989512871 5:42308946-42308968 TTTGGTCACCAAAATGTGCATGG + Intergenic
994735284 5:103546464-103546486 TGTGGACCTCAAAGTTTTCATGG - Intergenic
998835610 5:146200426-146200448 AAGGGACCTCAAAAAGTTCATGG - Intergenic
1000857045 5:166412011-166412033 TATAGACCTCAGAATGTACAAGG + Intergenic
1004824714 6:19406401-19406423 ATTGGACCCCAAAATGCTAAGGG - Intergenic
1005132211 6:22522288-22522310 TATGGACCCCTAATTTTCCATGG - Intergenic
1009815276 6:68725285-68725307 TATAGATCCCTAAATGTTTAAGG + Intronic
1014884517 6:126763531-126763553 TCTGTACTCCAAACTGTTCATGG + Intergenic
1015744765 6:136498166-136498188 TGTGGACCCCAAAAGTTTTAGGG + Intronic
1016628618 6:146201317-146201339 TATTTACCAGAAAATGTTCAAGG + Intronic
1018265599 6:162021517-162021539 AAGGGACTTCAAAATGTTCATGG - Intronic
1021456652 7:20836216-20836238 TATGGACCCAAAATTCTCCAGGG + Intergenic
1022015614 7:26346196-26346218 TCTGGACCCCAAAGAGTCCAAGG - Intronic
1022994197 7:35737805-35737827 TATGCACACTAAAATGTTTAGGG + Intergenic
1024412447 7:49060756-49060778 CATGGAACCCAAAATGATGAAGG + Intergenic
1028612546 7:92727850-92727872 AATGTAGCACAAAATGTTCAAGG + Intronic
1030794745 7:113773827-113773849 TAAGAATCCCAAAATGTTAAAGG + Intergenic
1031461335 7:122053087-122053109 TATGGACCCTGAAGGGTTCATGG + Intronic
1031819425 7:126480941-126480963 TTTGTACCCCAAGATGTTCCAGG - Intronic
1032997399 7:137463302-137463324 TATCTACCCCAAACCGTTCATGG - Intronic
1037740972 8:21608959-21608981 TGAGGACCCCAAAATGACCAGGG - Intergenic
1039338644 8:36622591-36622613 TTTGGATCCTTAAATGTTCAAGG - Intergenic
1044710662 8:95054302-95054324 AATGGTTCCCAAAATGTTCCTGG + Intronic
1044780592 8:95739810-95739832 TATTGAGCACAAAATGTTCTGGG + Intergenic
1046348771 8:112975942-112975964 TCTGGACCCCAACACGTCCAAGG - Exonic
1046548936 8:115687775-115687797 TATGGTCCACAAGATGTACAAGG - Intronic
1055221694 9:73941110-73941132 TGTGGAGCCTAAAATGTTCTGGG + Intergenic
1055672842 9:78624490-78624512 AATGGTCCCCAAAATGTTGTTGG - Intergenic
1056887183 9:90454696-90454718 TATGTACCCCAAAGTATTTAGGG - Intergenic
1060149322 9:121277964-121277986 TATGGAGCCTAAAATATTTACGG + Intronic
1061634272 9:131896628-131896650 GAAGTACCCCAAAATGTTAATGG - Intronic
1062400290 9:136369806-136369828 TAAGGACTCCAAGATGTACAAGG - Exonic
1186064701 X:5750387-5750409 AATCTACCCCAAAATGTTCTTGG + Intergenic
1186809455 X:13174060-13174082 TATGGGCCACTTAATGTTCAGGG - Intergenic
1186973685 X:14876453-14876475 TATGGACACAAAAATGTGCTTGG - Intronic
1189445745 X:41079244-41079266 TTTGGACCATAAAATTTTCATGG + Intergenic
1189824678 X:44906093-44906115 TATGGAGGCCCAAATGTTGAGGG - Intronic
1190001338 X:46690469-46690491 TAAGGAACCCAAAATGTATAAGG - Intronic
1190055912 X:47180987-47181009 GATGAACGCCAAAATGTTCCAGG - Intronic
1190378299 X:49813052-49813074 CATGGACCCCAAAATATTTCAGG + Intergenic
1195375859 X:104227649-104227671 AATATACACCAAAATGTTCATGG + Intergenic
1196491377 X:116271473-116271495 TATATACCCCAAAGTGTTGATGG + Intergenic
1197770858 X:130088379-130088401 TAGAGACCCCAAGATGTGCAGGG + Intronic
1198110455 X:133498274-133498296 TTTGGAACTCAAAATGGTCAGGG + Intergenic
1199145048 X:144355389-144355411 AATGGAACAAAAAATGTTCATGG - Intergenic
1199263736 X:145805940-145805962 TAGGGACCCCAGCATGTTCTGGG + Intergenic
1200360043 X:155595421-155595443 TATGGATCCCATGATGTTTAAGG - Intronic
1201224853 Y:11808868-11808890 AATGGAGCCCAAAAGGTACATGG - Intergenic
1201855572 Y:18536709-18536731 TATGGACCTCAGAATGCACATGG - Intergenic
1201877749 Y:18783676-18783698 TATGGACCTCAGAATGCACATGG + Intronic