ID: 981953481

View in Genome Browser
Species Human (GRCh38)
Location 4:150441239-150441261
Sequence TTATCCTGCTTTGTCTTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981953481_981953482 -5 Left 981953481 4:150441239-150441261 CCTCTAAAGACAAAGCAGGATAA 0: 1
1: 0
2: 2
3: 23
4: 236
Right 981953482 4:150441257-150441279 GATAAGAACATATAGTACTGTGG 0: 1
1: 0
2: 0
3: 13
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981953481 Original CRISPR TTATCCTGCTTTGTCTTTAG AGG (reversed) Intronic
901448292 1:9321146-9321168 TTTTCCAGCTTTGTGTTTTGGGG - Intronic
902981020 1:20123284-20123306 TTGTCCTCCTTTATCTTCAGGGG - Intergenic
903731635 1:25500676-25500698 TCATCCTCCCTTGTTTTTAGAGG + Intergenic
905992449 1:42350410-42350432 TTATCCTGTATTGTCTGTATTGG - Intergenic
906594591 1:47063681-47063703 TTATTTTGCTTTGTCTTTGATGG - Intergenic
911790517 1:102010378-102010400 TTAACCTGCTTTTTTTTTATAGG - Intergenic
912122816 1:106493456-106493478 TTACCCTGCTTTGTATTAAACGG + Intergenic
912230639 1:107788510-107788532 TTTTTCTGCTTGCTCTTTAGTGG - Intronic
912239845 1:107894806-107894828 TTATTCTCCTCTGTCATTAGGGG - Intronic
916193248 1:162199062-162199084 TTATCCTGCTTCATTGTTAGGGG + Intronic
916422142 1:164647360-164647382 TTTTCCTCCTTTGGCTGTAGTGG - Intronic
916965502 1:169937758-169937780 TTTTACTGCTGTATCTTTAGAGG - Intronic
917098655 1:171424589-171424611 CTATCCAGCTTTGTCCTGAGGGG - Intergenic
918457896 1:184743572-184743594 TGATGCTGCTTTGACTTGAGTGG - Intronic
919281722 1:195498134-195498156 GTATTCAGTTTTGTCTTTAGAGG + Intergenic
922522466 1:226267566-226267588 TTCTCCTGTTTTATCTTCAGAGG - Intronic
1064612107 10:17114480-17114502 TCAGCCTGCTATGTTTTTAGAGG + Intronic
1066152020 10:32632211-32632233 TTATCTTGTTTTTACTTTAGTGG + Intronic
1066439215 10:35421808-35421830 TCATTCTGCTTTCTCTTCAGAGG + Intronic
1071705077 10:87989226-87989248 TTATTCTGCATGGTCTTTGGGGG - Intergenic
1072220187 10:93320222-93320244 GTTTCCTGCTTTGGTTTTAGGGG - Intronic
1073360170 10:102892099-102892121 ATAACCTGGTTTATCTTTAGAGG - Intronic
1074994251 10:118742216-118742238 CTATCCAACTTTATCTTTAGAGG + Intronic
1075208238 10:120465466-120465488 TTCTGCTGCTTTGTCTTTAGTGG - Intronic
1075842321 10:125515647-125515669 CCATCCTGCTTTGTCTCTAGCGG + Intergenic
1077641524 11:3886014-3886036 TTGTCCTGCTTTGGCTCAAGGGG + Intronic
1077736600 11:4798275-4798297 TCATCCTGCTCTGTCTTCTGAGG - Intronic
1078165151 11:8876535-8876557 TTATCCTGCTATGTTGTTTGGGG + Intronic
1079399898 11:20098313-20098335 TTATCCCCATTTGTGTTTAGGGG + Intronic
1080257049 11:30302176-30302198 TTATCATGCTCAGTCTTTACAGG + Intergenic
1086331974 11:85763207-85763229 TTATCCTTCTTTGTCCTCTGCGG - Intronic
1087522713 11:99262718-99262740 TTATTCTGCTTTGTTTTTAAGGG + Intronic
1088056486 11:105586292-105586314 CTATCCCGCCATGTCTTTAGTGG + Intergenic
1088186182 11:107174290-107174312 ATATCATGCTTTGTATTTTGTGG - Intergenic
1088224022 11:107599415-107599437 TTATTGAGCTTTTTCTTTAGAGG - Intronic
1088292364 11:108254336-108254358 TTTCCCTCCTTTGTATTTAGAGG - Intronic
1090331748 11:125938337-125938359 TCTTCCAGCTTTGTCGTTAGTGG - Intergenic
1090597753 11:128337252-128337274 TTATCCTGCTAACTATTTAGTGG - Intergenic
1090950161 11:131465885-131465907 TTACCCTGCTGTGGCTTTGGAGG - Intronic
1092864708 12:12750053-12750075 TTATTATGCTTTGTCTCTACCGG - Intronic
1094092327 12:26663802-26663824 TTCTCCTGCTTTCTCTTTAAAGG + Exonic
1094197440 12:27764208-27764230 AAATACTGCTTTGTCTTTATAGG + Intronic
1096720135 12:53515149-53515171 TTTCTCTCCTTTGTCTTTAGGGG + Exonic
1096759431 12:53828064-53828086 TTATATTTCTTTGTATTTAGGGG + Intergenic
1098129239 12:67331419-67331441 TTATCATGCTTTGACTGTTGGGG - Intergenic
1098763032 12:74448781-74448803 CTACCCTGGTCTGTCTTTAGAGG - Intergenic
1099197528 12:79635549-79635571 TTCTCCTGCTTTGTTTTTATAGG - Intronic
1099634999 12:85202545-85202567 TTATCCTTCTTGGTCTTTCCTGG + Intronic
1100325999 12:93540370-93540392 TTATGCTGCCTTCTCTTTGGTGG - Intergenic
1100819320 12:98416614-98416636 TTATCTTCATTTTTCTTTAGTGG + Intergenic
1100914012 12:99397612-99397634 TTTTCCAGCTTTGTCATTATGGG + Intronic
1103243459 12:119434662-119434684 TCACCCTGCTATGTCTTTATTGG - Intronic
1105322018 13:19335043-19335065 TGATCCTGTTATGTCTTGAGTGG + Intergenic
1105823315 13:24099200-24099222 TTATCCTGCTTTATCTCTACAGG + Intronic
1105876445 13:24559250-24559272 TGATCCTGTTATGTCTTGAGTGG - Intergenic
1106270585 13:28149616-28149638 TTGTTTTGCTTTGTTTTTAGAGG + Intronic
1109133022 13:58611793-58611815 GTATCCTGTTTTGTGTTCAGTGG + Intergenic
1109461417 13:62663829-62663851 TTCTCCTGCCTTTTCTTTAGGGG - Intergenic
1110481150 13:75978015-75978037 ATAAACTGCTTTGTTTTTAGTGG - Intergenic
1112635414 13:101212219-101212241 TTATAAAGATTTGTCTTTAGGGG - Intronic
1114234190 14:20810512-20810534 TTATCCTACTTTATCTTCATGGG - Intergenic
1114389696 14:22293840-22293862 GCCTCCTGCTTTGCCTTTAGAGG - Intergenic
1114514247 14:23287153-23287175 CTATCCTGTTTTGTCTTCAAAGG - Intronic
1114643683 14:24241763-24241785 AGATCCTGCTTTGTCTGTTGAGG + Exonic
1115271194 14:31555352-31555374 TTTTCCTGTTTTTACTTTAGAGG - Intronic
1115730409 14:36262522-36262544 TTTTCTTTCTCTGTCTTTAGGGG + Intergenic
1116924239 14:50617367-50617389 TTATCCTTTTTTTTCTTTTGAGG + Intronic
1117750362 14:58915969-58915991 TTAACCTCCTTTCTCCTTAGAGG - Intergenic
1118222026 14:63863356-63863378 TTCTCCTACTTTGGCTTTGGAGG + Intronic
1119313572 14:73672113-73672135 TTAGCCTGTTTTGTCTTGGGAGG - Intronic
1119766396 14:77192055-77192077 ATAGCCTCCTTTGTCTTTTGTGG + Intronic
1120278150 14:82404101-82404123 TTACCTTGCTGTGTCTTTAAGGG - Intergenic
1120589119 14:86354514-86354536 TTAAGCAGATTTGTCTTTAGAGG + Intergenic
1121224459 14:92311103-92311125 GTATTCTGCTTTTTCTTTAGGGG + Intergenic
1121297623 14:92842384-92842406 TTATACTGCTTTTTATTTATAGG + Intergenic
1124867409 15:33506132-33506154 TTAACTTGGTTTGTCTTAAGGGG + Intronic
1125168999 15:36744254-36744276 TTATCCTGGTTTCTCCATAGGGG + Intronic
1128407029 15:67352784-67352806 TTATCCTGCTTTGTATTTATTGG + Intronic
1129615385 15:77095016-77095038 TTATCCTTCCTGGTCTCTAGGGG + Intergenic
1132083552 15:98887588-98887610 TCACCATGCTTTGTCATTAGAGG - Intronic
1133295019 16:4747453-4747475 TGATCCAGCTGTGTCTTCAGGGG - Exonic
1133429312 16:5722887-5722909 TTATCCTGTGTTTTCTTTTGTGG + Intergenic
1137986503 16:53112994-53113016 TTGTTTTGTTTTGTCTTTAGAGG - Intronic
1140025101 16:71281183-71281205 TTATCCAGCTTTTTTTTTAAAGG + Intergenic
1141735875 16:85852761-85852783 TTGTCCTGCTTTGTCCTTGCTGG - Intergenic
1144564147 17:16345885-16345907 TTTTCCTGGTTTGTCCTTTGTGG - Intronic
1148010047 17:44471680-44471702 TTAAGCTGTTTTGTTTTTAGGGG - Intronic
1149959178 17:61088542-61088564 TCTTTCTGCTTTCTCTTTAGAGG - Intronic
1149960869 17:61108582-61108604 CTATCTTGATTTGTCTATAGTGG + Intronic
1151202784 17:72480977-72480999 CTACCCTGATTTGTCTTTTGGGG + Intergenic
1151239390 17:72745962-72745984 TTCTCTTACTCTGTCTTTAGGGG - Intronic
1151409681 17:73913885-73913907 TTATCCAGCTTTTTCTTGATAGG - Intergenic
1152818202 17:82421315-82421337 TTTCCCTGTTTTGTCCTTAGTGG - Intronic
1153196481 18:2603611-2603633 TTTTCCTGCTTTTTCTTAAATGG - Intronic
1153552374 18:6275064-6275086 TTCTCCTGCAATGTCTCTAGAGG - Intronic
1154088086 18:11327021-11327043 TTATCCTGCATTGTCTGCATGGG + Intergenic
1155243363 18:23884497-23884519 TTACTCTGCTCTGTCTTAAGGGG + Intronic
1155952745 18:31931005-31931027 TTATCTTGCTTGGTGTTAAGTGG - Intronic
1156544635 18:37951809-37951831 TTATTTTGCTTTGTTTTGAGAGG - Intergenic
1156810799 18:41248430-41248452 TTATCCTGCTTGGAATTTATAGG - Intergenic
1157634660 18:49139698-49139720 TTATCAGGCTTAGTTTTTAGAGG + Intronic
1158250585 18:55483022-55483044 TTATGCAGCTTTTTCTTCAGTGG - Intronic
1159006525 18:63017890-63017912 TTATTCTGTTTTGTCTTCTGTGG - Intergenic
1159396934 18:67871507-67871529 TTATCTTGGTTTATCTCTAGTGG - Intergenic
1159545576 18:69836674-69836696 TTTGCCTTATTTGTCTTTAGTGG + Intronic
1161354082 19:3809513-3809535 TTTTCCTGCTGTGACTGTAGAGG - Intronic
1167851569 19:52206249-52206271 TTATCATCCTTTCTGTTTAGTGG + Intronic
1167977836 19:53245599-53245621 TTGTCCTTTTTTTTCTTTAGTGG - Intronic
927223562 2:20738422-20738444 ATATCCTACTTTGTCTATGGAGG + Intronic
928348958 2:30529135-30529157 TTATCCTAATTTATTTTTAGTGG - Intronic
929235569 2:39601834-39601856 TTATGCTGTTTTCACTTTAGTGG + Intergenic
933217524 2:79647419-79647441 TTATCCTGATTTTTCATTTGAGG + Intronic
933405986 2:81860255-81860277 CTATGCTGCCTTGGCTTTAGAGG - Intergenic
935205476 2:100893115-100893137 TTATCTTCCTTTGTCATTTGGGG - Intronic
935540399 2:104341212-104341234 ATATCATGCTTTGGCTTTGGAGG - Intergenic
937041531 2:118824423-118824445 TTATCTTGCTGTGTCTTTCTCGG - Intergenic
937816924 2:126260857-126260879 TTTTACAGCTTTGCCTTTAGAGG - Intergenic
939235743 2:139490039-139490061 TTATCCTGCTTTTTTTTTTGTGG + Intergenic
939533511 2:143394856-143394878 TTATCTTGCTATGTCTTATGAGG + Intronic
939855582 2:147354841-147354863 TTTTCCTGCTTTGTATGTGGGGG - Intergenic
942041342 2:172066756-172066778 TTATCTTACTCTGTCATTAGGGG + Intronic
942896702 2:181064995-181065017 TTGTCCTGCTTTTTCTTTTGGGG + Intronic
945382814 2:209161454-209161476 TTATCCTTGTTTTTGTTTAGGGG + Intergenic
947645822 2:231738977-231738999 TTAACATGCTGTGTCTTCAGGGG + Intronic
1169862385 20:10166369-10166391 TGATCCTTCTTTATCCTTAGTGG - Intergenic
1170187910 20:13612441-13612463 TTATCATGTTTTGTCTTGATAGG - Intronic
1174844238 20:53928070-53928092 CTGTCCTGCTTAGTCTTCAGTGG + Intergenic
1176786006 21:13257246-13257268 TTATTTTGCTTTATCTTTAGAGG - Intergenic
1177719323 21:24883973-24883995 TTCTCCTGCAATGTATTTAGTGG + Intergenic
1177984029 21:27950948-27950970 TTATTTTGCTTTATCTTTAGAGG - Intergenic
1177984221 21:27953051-27953073 ATATTTTGCTTTATCTTTAGAGG - Intergenic
1178088575 21:29137582-29137604 TGCTCCTGCTTTCTGTTTAGAGG - Intronic
1178159989 21:29901169-29901191 TTGTCCTGCTTTCTCTTGTGGGG - Intronic
1180198217 21:46209785-46209807 TTTTGCTGTTTTGTCTTTAAAGG - Intronic
1181452032 22:23029400-23029422 GTAACCTGGTTTGTCTTTAGAGG - Intergenic
1181452142 22:23030410-23030432 TTACCATGATTTCTCTTTAGTGG + Intergenic
1181452153 22:23030565-23030587 ATAACCTTGTTTGTCTTTAGAGG - Intergenic
1185384865 22:50526987-50527009 CTAACCTGCTGTGACTTTAGAGG - Intronic
1185404312 22:50638071-50638093 TTACTCTGATTTGTCTTTTGTGG + Intergenic
949149082 3:742653-742675 TTGTCCTGCTGTGTCAGTAGTGG + Intergenic
949432072 3:3987980-3988002 TTAGTCTTCCTTGTCTTTAGGGG - Intronic
952797109 3:37249592-37249614 TCTTCCTGTTTTGTCTTTGGTGG + Intronic
953963046 3:47281776-47281798 GTTTCCTCATTTGTCTTTAGTGG + Intronic
956874821 3:73452029-73452051 ATAACCTGCTATGTCTTTATGGG + Intronic
957325267 3:78684060-78684082 TTATCTTGGTTTGCCTTTAGTGG - Intronic
957971832 3:87391696-87391718 TTATTCTTCTTTGTCTTCATTGG - Intergenic
958195592 3:90238611-90238633 TTATCCTGATTGATGTTTAGTGG - Intergenic
958509763 3:95032683-95032705 TTGTCTTGCTTTGGCTATAGGGG + Intergenic
959019214 3:101169931-101169953 TTTTCCTGCTTTGGGTTTGGAGG - Intergenic
959373843 3:105563309-105563331 TTATCTTTCTTAGTCTTTATAGG + Intronic
962292974 3:134152779-134152801 TTTTAATGATTTGTCTTTAGAGG - Intronic
964643958 3:158937920-158937942 TTATCCTTTTTTGTCTTTGTTGG - Intergenic
965417622 3:168416692-168416714 CCATCCTGCTTGGTCATTAGAGG + Intergenic
965467752 3:169053504-169053526 TTATCCTCCTTGGTCATGAGTGG + Intergenic
965925824 3:173978488-173978510 TTATCCTTCTTTGTTTTCATAGG - Intronic
967946929 3:194811426-194811448 TTATCCTGATTTGCCTTTTAAGG - Intergenic
968014888 3:195320426-195320448 TTATAATGCTTGGTCTATAGTGG - Intronic
968762583 4:2450334-2450356 TTACCTTGCTTTTTCTTTATTGG - Intronic
970053175 4:11939377-11939399 TCATCCTGCTGTGTCTTCACAGG - Intergenic
971836163 4:31765968-31765990 TTATTCTTCTTTGTTTTTACAGG - Intergenic
971935703 4:33144221-33144243 TTATCTTTCTTTTTCTTTTGAGG + Intergenic
971989488 4:33872848-33872870 CTTTTCTGCTTTGTCTTCAGTGG + Intergenic
974696579 4:65383476-65383498 TTTTCTTGCTTTGTTTTTACTGG - Intronic
975078804 4:70249271-70249293 TTATCCTGAATTTTCTTTGGGGG - Exonic
975609139 4:76186544-76186566 GTATCCTGCTTTGTATCTACAGG - Intronic
975854593 4:78610401-78610423 TTATCTTGCTTTATATTTAATGG - Exonic
976014923 4:80540958-80540980 TGATCCTTCTTTGTGGTTAGAGG - Intronic
977556287 4:98490300-98490322 TCATACTTCTTTGTCTTTGGGGG - Intronic
977780471 4:100975680-100975702 TTGTCCTCCTTTGTCATCAGAGG - Intergenic
978463702 4:108984948-108984970 TTATCCTGTGTTGTGCTTAGGGG - Intronic
980064859 4:128175569-128175591 TTATCCTTCCTTGTCTGTAAAGG - Intronic
980592372 4:134906935-134906957 TTGTTCTGCGTTGTCTTTATTGG + Intergenic
981953481 4:150441239-150441261 TTATCCTGCTTTGTCTTTAGAGG - Intronic
983185825 4:164699514-164699536 TTATTCTTCTTTCTCTTTACTGG - Intergenic
983745023 4:171187523-171187545 TTATCCTGATTTATCCTTATAGG - Intergenic
985072189 4:186177409-186177431 TTGTGCTGCTTTGTCTTGGGGGG - Intergenic
987525096 5:19037882-19037904 TTAACCTGCTTTATATTTATTGG - Intergenic
989721761 5:44537288-44537310 TAATCCTGCTTTTTTTTTAGAGG - Intergenic
991196313 5:63936977-63936999 ATATTCTGCTTTATGTTTAGTGG - Intergenic
991503363 5:67299846-67299868 TTCTCCTCCTTTGCCTTTAATGG - Intergenic
993272129 5:85809967-85809989 TTGACCTGGTTTGTCTTTAGAGG + Intergenic
993318963 5:86448324-86448346 TTATCTTTCTTTGTCTATAATGG - Intergenic
993653934 5:90555398-90555420 TTATCCTACTTTTACTTTTGGGG + Intronic
994288983 5:98004507-98004529 TTCTCCTTCTTTGTCTTAACAGG + Intergenic
995051822 5:107715447-107715469 TTAGTCTGCTTTGTTTTCAGGGG + Intergenic
1003374339 6:5561648-5561670 TTATCCTGCTTAGTATTTGGAGG + Intronic
1004325042 6:14666823-14666845 TTATCCAGCTATGTCTCTAAAGG + Intergenic
1006473135 6:34239062-34239084 TTATCCTGCTCCGTCATTAGTGG - Intronic
1007262904 6:40576226-40576248 TTATGCTGCTTTGTATTTATTGG - Intronic
1009652348 6:66492061-66492083 TTTTCCTGCTTTTTCTTGTGGGG - Intergenic
1010740333 6:79495358-79495380 TTATCCCTCTGTGTCTGTAGGGG + Intronic
1010803100 6:80200914-80200936 TTTTCCTGTTCTGTATTTAGCGG + Exonic
1011119801 6:83939448-83939470 TGATCTTGCTTTGTTTTTATGGG + Intronic
1013873713 6:114799061-114799083 TTAAACTACTTTGTCTTCAGCGG + Intergenic
1014390849 6:120861670-120861692 TTATGATTCTTTGTATTTAGTGG - Intergenic
1014471281 6:121817770-121817792 TTATCTTCCTTTGTTTTTACTGG + Intergenic
1014950266 6:127546101-127546123 TTATCCTGCATTGGATTAAGTGG + Intronic
1015783250 6:136893443-136893465 TCATCCTGCATTGTCTTTTGGGG + Intronic
1016178779 6:141117087-141117109 TTTTGCTGCATTGTCTCTAGAGG + Intergenic
1017543898 6:155430563-155430585 TTATTTTGCTTTCTCTCTAGGGG - Intronic
1017583073 6:155888372-155888394 TTGTTTTGCTTTGTTTTTAGTGG + Intergenic
1017698708 6:157046206-157046228 TTTTCCAATTTTGTCTTTAGAGG + Intronic
1018551540 6:165003779-165003801 TTATTCTGCTTTTCCTATAGTGG + Intergenic
1020214780 7:6181612-6181634 TTATCCTGCTTGGCATTTGGTGG + Intronic
1020406126 7:7836990-7837012 TTATTCTTCTTTGTGTTTGGGGG - Intronic
1022356233 7:29617296-29617318 TTATCCTGCATTATCTTGATGGG + Intergenic
1023164594 7:37331007-37331029 TTATCCTGCTTTGTCCCTCCAGG - Intronic
1024112084 7:46157730-46157752 GTTTACTGCTTTGTCTTAAGTGG + Intergenic
1024388773 7:48783377-48783399 TTTTCCTGCTCTTTGTTTAGTGG + Intergenic
1026646940 7:72179392-72179414 TTAACCTGTTTGGTCTTTGGGGG - Intronic
1028204311 7:87998359-87998381 TTCTCCTGCATTGTCTGAAGGGG - Intronic
1028910034 7:96197445-96197467 TTTTCCTCCTTTGTCTCTTGGGG - Intronic
1029574700 7:101395785-101395807 TTGGCCTGCTTTGTTTTCAGCGG - Intronic
1030244216 7:107363239-107363261 GAATCCTGCTTTGTTTTTATTGG - Intronic
1030397728 7:109008981-109009003 TTATTCTGTTTTCTCTTCAGGGG + Intergenic
1030541065 7:110831280-110831302 TTTTCCTGCTTTGCTTTTAAGGG + Intronic
1031240779 7:119236678-119236700 TTATCCTGGATTGTATTTTGAGG - Intergenic
1031983159 7:128142924-128142946 TAATGCTGCTTTTTCTCTAGGGG + Intergenic
1033313008 7:140276171-140276193 GTTTCCTGCTTTGTAGTTAGAGG - Intergenic
1035758610 8:2052666-2052688 TTATCCTGCTCTGTCTGGAAAGG - Intronic
1036061172 8:5322877-5322899 TTATCATGCTTTTTCTCTACTGG + Intergenic
1036531976 8:9599145-9599167 TTATGCTTCTTTTTATTTAGGGG - Intronic
1042163390 8:65921065-65921087 TTATCCTCCTTTTCCCTTAGTGG + Intergenic
1042396697 8:68299821-68299843 TTATACTGATTTATCTTCAGGGG - Intergenic
1043248138 8:78032677-78032699 ATCTCGTGGTTTGTCTTTAGGGG - Intergenic
1044254270 8:90041642-90041664 TTAGCTTGCTTTTTCTTTATGGG + Intronic
1045902024 8:107293407-107293429 AGCTCCTGCTTTGTCTTTGGAGG + Intronic
1046238291 8:111456731-111456753 TCAGCCAGCTTTATCTTTAGGGG - Intergenic
1046743838 8:117856221-117856243 TTACTCTGCTTTGGCTTAAGGGG - Intronic
1047847002 8:128817219-128817241 ATATTCTCCTTTGTCTTCAGAGG - Intergenic
1048566291 8:135601152-135601174 TTGGCCTGCTTTGCCTCTAGAGG + Intronic
1048827429 8:138442564-138442586 TTATTTTGCTTTGTGTTTGGTGG - Intronic
1050103078 9:2138792-2138814 TTCTCCAGCTTTGCCTTTGGCGG + Intronic
1050318658 9:4428728-4428750 ATATCTTGCTTTGGCTTTTGCGG - Intergenic
1050984370 9:12063452-12063474 TTAGCCTGCTTTTTCTGTATAGG + Intergenic
1051446568 9:17146132-17146154 TTATCCTTCTTAGCCTTTGGTGG + Intronic
1051496091 9:17725303-17725325 TTAGCCTTCTTTGTCTCTAGGGG + Intronic
1051714331 9:19965609-19965631 TTAACCTGTTTTGTCTTAAGTGG + Intergenic
1052438805 9:28466122-28466144 ATATACTGCTTTGTTTTTTGGGG - Intronic
1054710384 9:68505082-68505104 TTATCCTGCTTTGCTTTTGCAGG + Intronic
1055940783 9:81647520-81647542 ACCTCCTCCTTTGTCTTTAGTGG - Intronic
1056214733 9:84396605-84396627 TAATTTTGCTTTGTCTTTTGTGG + Intergenic
1056982035 9:91323084-91323106 TTATCTTTCTTTGACTTTGGTGG - Intronic
1057927308 9:99164835-99164857 TTATCCTGCTTGGTACTTAGTGG + Intergenic
1058043773 9:100334161-100334183 TTATTCTGCTTGGGATTTAGTGG - Intronic
1058317348 9:103585679-103585701 TTATCATACTTTGTATTTAATGG - Intergenic
1059194071 9:112354189-112354211 GTTTCCTGATTTGTCTTTAGTGG + Intergenic
1187303968 X:18078249-18078271 ATTTCCTGCTTTCTTTTTAGGGG + Intergenic
1188081579 X:25848658-25848680 TTATCCTGCTTTGGGTTTTCTGG + Intergenic
1188867787 X:35335331-35335353 TTTTCCTACTTTCTTTTTAGAGG + Intergenic
1190435897 X:50424865-50424887 TTACCATGGTTTGTCTTCAGCGG + Intronic
1192184549 X:68938231-68938253 CTTTCCTGTTTTGACTTTAGTGG - Intergenic
1193828909 X:86263045-86263067 TTTTTCTCCTTTTTCTTTAGCGG - Intronic
1194289263 X:92049235-92049257 TTATCCTGCAATGTCTCTTGTGG - Intronic
1194437981 X:93893478-93893500 CTAAGCTGCTTTTTCTTTAGGGG + Intergenic
1196034594 X:111130407-111130429 TTCTCCTGCTAGGTCTTCAGTGG - Intronic
1196085917 X:111681887-111681909 TTTTCCTGCTGTGGCTTTCGCGG + Intronic
1196314287 X:114204471-114204493 TAACCCTGCTCTGTCTATAGAGG + Intergenic
1196657263 X:118231670-118231692 TTATCCTGGTTTGTGGTTTGTGG - Intergenic
1198136896 X:133762053-133762075 TTATCCTACTTTGTCCCCAGAGG - Intronic
1200606781 Y:5273809-5273831 TTATCCTGCAATGTCTCTTGTGG - Intronic
1202587360 Y:26445556-26445578 TTATCCTTCGATGTCTGTAGGGG + Intergenic