ID: 981955689

View in Genome Browser
Species Human (GRCh38)
Location 4:150470315-150470337
Sequence GGTAAGTCAGATGTCTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981955689_981955692 9 Left 981955689 4:150470315-150470337 CCTCTCAAGACATCTGACTTACC 0: 1
1: 0
2: 0
3: 4
4: 128
Right 981955692 4:150470347-150470369 CTACTATATCTGCACATTCTAGG 0: 1
1: 0
2: 0
3: 17
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981955689 Original CRISPR GGTAAGTCAGATGTCTTGAG AGG (reversed) Intronic
902134420 1:14292571-14292593 GGCAAGTCAGATGCCTGCAGTGG - Intergenic
904479359 1:30784356-30784378 GGAAAGTCAAAGGTCTTGGGAGG - Intergenic
907039281 1:51243764-51243786 GCTAAGTCAGATATCTTCAGTGG - Intronic
915516552 1:156416143-156416165 GGGACCTCAGAGGTCTTGAGGGG - Intronic
918435147 1:184503456-184503478 GGAAAACCAGCTGTCTTGAGGGG - Intronic
918906707 1:190505681-190505703 GGTGAGGCAAATGTCTGGAGTGG - Intergenic
919697614 1:200594577-200594599 AGTAAATTAGATGTCTTAAGGGG - Intronic
920256615 1:204659533-204659555 CGTAAGACAGATGTCCTGGGAGG - Intronic
1063382691 10:5596157-5596179 GGTGAGTCAGATGCCTTCGGGGG - Intergenic
1067496423 10:46764436-46764458 GGTGAGGCAGATGTCTGGATTGG + Intergenic
1067598231 10:47575961-47575983 GGTGAGGCAGATGTCTGGATTGG - Intergenic
1068922086 10:62495419-62495441 GGTAAAACAGATTTCTTTAGTGG - Intronic
1069239701 10:66123951-66123973 GGTATGTCAGAGGTCTTCATGGG - Intronic
1070580303 10:77713952-77713974 GGAAAGGCAGATGGCATGAGTGG + Intergenic
1072565899 10:96616327-96616349 GGAGAGTCAGATGTCTGCAGAGG + Intronic
1075580315 10:123612472-123612494 CTTAAGTCAGATGTATTGATGGG + Intergenic
1076744839 10:132507664-132507686 GGTGAGTCAGGTGTGCTGAGTGG - Intergenic
1077022786 11:426667-426689 CGAAAGCCTGATGTCTTGAGTGG - Intronic
1079228482 11:18628945-18628967 GCAAATTCAGATGTCTTCAGGGG - Intronic
1080590538 11:33719681-33719703 GACAAGACAGATGTCTGGAGAGG + Intronic
1083808034 11:65086750-65086772 GAGAAGTCAGACGTGTTGAGGGG - Exonic
1088096379 11:106105685-106105707 GGCAGGTAAGAGGTCTTGAGAGG - Intergenic
1090846330 11:130532831-130532853 GGCATGTCACATGGCTTGAGAGG - Intergenic
1092223873 12:6733778-6733800 GGTAAGCTTGTTGTCTTGAGCGG + Intergenic
1095949690 12:47775136-47775158 GGGAAGTCAGATGTCTTTTGGGG - Intronic
1096040550 12:48511933-48511955 GCTAAGTCACATGTTTTGAAAGG + Intronic
1098285623 12:68904176-68904198 GGCAAGTCAGGTCTCTTGAAAGG + Intronic
1098972809 12:76873812-76873834 GGTAAGGCAGTTGCCTTGATGGG - Intronic
1106793780 13:33183664-33183686 GGGAAGTCAGATTTGGTGAGGGG + Intronic
1108542847 13:51460431-51460453 GGTATGTCAGATGACGAGAGAGG - Intergenic
1112247649 13:97749106-97749128 GGTCAGGCAGGTGACTTGAGGGG - Intergenic
1114262861 14:21051424-21051446 GGTAAGTCAGAGGTCTCAGGAGG + Intronic
1114786207 14:25602704-25602726 AGTAAGTCAAATGCCTTCAGTGG - Intergenic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1116268988 14:42736197-42736219 GGTAGGTCAGAAGTCTGGATTGG - Intergenic
1117183724 14:53218043-53218065 GGTTACTCACATGTATTGAGAGG - Intergenic
1117874903 14:60242247-60242269 GGAAATTGAGAAGTCTTGAGGGG - Intergenic
1119028835 14:71175679-71175701 GATGAGTCAGCTGTGTTGAGGGG + Intergenic
1120514221 14:85451525-85451547 AGAAATTCAGATATCTTGAGGGG - Intergenic
1125930339 15:43595234-43595256 GGAAAGTGAGAGGTCTTTAGGGG - Intronic
1125943507 15:43695066-43695088 GGAAAGTGAGAGGTCTTTAGGGG - Intronic
1127283232 15:57509960-57509982 GGTAAGTCAGGTTTCTTGGTTGG - Intronic
1128855058 15:71003505-71003527 TGTGAGTCAGATTTCTAGAGTGG - Intronic
1131019408 15:89085827-89085849 GGAAAGTGAGATGTCTTGTTAGG - Intergenic
1131310803 15:91288120-91288142 GGCAAGTCAGATCTCTGGGGTGG + Intronic
1131790713 15:95961301-95961323 GGTAAGTCAGACGTGATCAGAGG + Intergenic
1135196548 16:20399571-20399593 GGGAAGTCAGTGGGCTTGAGTGG - Intronic
1139828168 16:69774068-69774090 GATAATTCAGATGTCTAGAAAGG + Intronic
1147806917 17:43138433-43138455 GCTAAGTCAGAGGCCTGGAGAGG - Intergenic
1147921367 17:43919111-43919133 GCTAAGTCAGAGGCCTGGAGAGG - Intergenic
1148168869 17:45503040-45503062 GCTAAGTCAGAGGCCTGGAGAGG - Intergenic
1148279947 17:46339975-46339997 GCTAAGTCAGAGGCCTGGAGAGG + Intronic
1148302165 17:46557831-46557853 GCTAAGTCAGAGGCCTGGAGAGG + Intronic
1148366644 17:47060349-47060371 GCTAAGTCAGAGGCCTGGAGAGG + Intergenic
1150400064 17:64849497-64849519 GCTAAGTCAGAGGCCTGGAGAGG - Intergenic
1150543535 17:66129221-66129243 GGTAAGTGAGCTGTCGTGATTGG - Intronic
1150947816 17:69766017-69766039 GGGAAGTCAGATTTCTTGCATGG + Intergenic
1152858972 17:82684620-82684642 GACAAGTCAGATGGCTTCAGAGG + Intronic
1153275711 18:3365568-3365590 AGAAAATCAGATGTATTGAGAGG + Intergenic
1159747842 18:72261017-72261039 TGTAAGTCAAATGTCTTTTGGGG - Intergenic
1164701571 19:30288370-30288392 ATTAGGTCAGCTGTCTTGAGGGG + Intronic
925680712 2:6418355-6418377 GGAAATTCAGATGAATTGAGAGG - Intergenic
929800234 2:45093559-45093581 GGTAAATCAGATCTGTAGAGAGG + Intergenic
930100086 2:47596655-47596677 GGACAGTCAGATGACCTGAGGGG + Intergenic
937815023 2:126241804-126241826 GGTAAGTCATGTGTCTTGTCTGG - Intergenic
940063664 2:149601236-149601258 TGCAAGCCAGATGTATTGAGAGG - Intergenic
940735405 2:157445713-157445735 GGTGAGTCAGTTGGCCTGAGTGG - Intronic
942385174 2:175435095-175435117 GGTAAGACAGCTGGGTTGAGGGG + Intergenic
943916302 2:193637345-193637367 GGGAAGAGAGATGTATTGAGAGG - Intergenic
945469125 2:210206877-210206899 GGTAAGCCACATTTCTTGATAGG + Intronic
946276778 2:218637555-218637577 GGAAAGGCAGATGACTAGAGAGG - Intergenic
946452341 2:219791588-219791610 GGGAAGCCAGATGTCATGTGTGG + Intergenic
1168931680 20:1629490-1629512 GGGCAGGCAGATGTCTTGGGAGG + Exonic
1169433400 20:5560775-5560797 GTTAATTCAGATGTCATGATTGG - Intronic
1176202509 20:63868575-63868597 GCTCTGTCAGATGTGTTGAGAGG + Intronic
1179076001 21:38122161-38122183 GGTGAGGCAGCTGTCTTCAGAGG + Intronic
949337056 3:2986376-2986398 GTTAAGTAAGTTGTCTTTAGTGG + Intronic
955566718 3:60255385-60255407 GCAAAGACAGATGTCTTTAGGGG + Intronic
956113912 3:65899405-65899427 GATAAGTCTGATTTCTTCAGCGG - Intronic
963259520 3:143178145-143178167 GGTAAGTAAGCTGTCTGGAGGGG - Intergenic
966296763 3:178432738-178432760 GGTAAGTCACATGGCAGGAGAGG - Intronic
971987169 4:33840867-33840889 GTTGAGTCAGATGTCTTGTTAGG + Intergenic
973187623 4:47349250-47349272 GGTAAGGAAGATGGCTTGGGAGG + Intronic
974226248 4:59049307-59049329 AGTAAGTCTGATGGATTGAGAGG + Intergenic
981955689 4:150470315-150470337 GGTAAGTCAGATGTCTTGAGAGG - Intronic
982241790 4:153307251-153307273 GGTAAGTCAGATGATGTGGGAGG + Intronic
984992679 4:185396518-185396540 GGTAAGTCAGTGGGCGTGAGAGG - Exonic
987394507 5:17409597-17409619 GGTAAGTTGCATGTCTTGGGGGG + Intergenic
988003128 5:25375098-25375120 TGTAAGTCAGAAGTCTGAAGTGG - Intergenic
988028977 5:25738666-25738688 GGTAAGTGAGGGGTCCTGAGTGG + Intergenic
990342346 5:54835978-54836000 AATAAGTCAGATTTCTTGAATGG - Intergenic
990863005 5:60349195-60349217 CTTAAGTCAGATGTGTTCAGTGG - Intronic
993045129 5:82857911-82857933 GGGAAGTCAGATGACTTCTGGGG - Intergenic
993288959 5:86040101-86040123 GGTAGGTCTGATGTCTGGGGAGG + Intergenic
994009645 5:94885762-94885784 GGTAAGTAAGTTGTACTGAGAGG + Intronic
994750734 5:103734065-103734087 GGTAGGTCTGATGTCTGGTGAGG + Intergenic
995171077 5:109112977-109112999 GGAAAGACAGATGACTCGAGAGG - Intronic
995430277 5:112067143-112067165 GGTGACTCAGATGTCCTCAGGGG - Intergenic
997440647 5:133906473-133906495 GGTGAGCCAGATTTCTAGAGGGG - Intergenic
999626414 5:153525440-153525462 GGTACATGAGATGTTTTGAGGGG - Intronic
1002159102 5:177304430-177304452 GGTCAGTCAGATGGCGGGAGTGG + Intronic
1002211522 5:177602193-177602215 GGTAAGTCAGAAGCCCTGGGGGG + Intronic
1007302685 6:40879995-40880017 AGAAATTCAGATTTCTTGAGGGG - Intergenic
1007887439 6:45246740-45246762 GTCAAGGCAGATGTCTTAAGGGG + Intronic
1012212508 6:96538984-96539006 TTTAAGTCAGATGTTTTGATGGG - Intronic
1015895376 6:138011673-138011695 GGTAAATGAGATGTACTGAGAGG + Intergenic
1016934686 6:149440985-149441007 GGAAACTCAGAGGTCCTGAGTGG - Intergenic
1020610590 7:10391842-10391864 GGTAATTAAGATTTCTTGGGAGG + Intergenic
1021906103 7:25334994-25335016 GATAACTCAAATGACTTGAGAGG - Intergenic
1024374421 7:48620974-48620996 GGAAAGCCAGAGGTCCTGAGAGG + Intronic
1028928771 7:96389746-96389768 GCTAAGTCAGATTTCTTCTGTGG + Intergenic
1033023090 7:137746899-137746921 GCTAACTCTGATGTTTTGAGAGG - Intronic
1037806672 8:22061697-22061719 GGTGAGTCAGAGGTTTGGAGGGG - Intronic
1037827641 8:22168719-22168741 GGTGACTCAGCTGTCTAGAGGGG - Intronic
1039076801 8:33697841-33697863 ACTAAGTTAGATGTCTTCAGCGG + Intergenic
1039635316 8:39158398-39158420 GGAAATTCAGAGGCCTTGAGGGG + Intronic
1043323661 8:79022716-79022738 GTTAATACAAATGTCTTGAGTGG - Intergenic
1044058215 8:87599286-87599308 GCTAAGCCTGATGTCTTCAGCGG - Intronic
1047214698 8:122866639-122866661 GGGAAGACAGATGGCATGAGGGG + Intronic
1048254156 8:132893036-132893058 GGTATGTGATGTGTCTTGAGTGG + Intronic
1049322685 8:142005384-142005406 CATAAGCCAAATGTCTTGAGTGG + Intergenic
1050542598 9:6682841-6682863 GTTACGTCAAACGTCTTGAGAGG - Intergenic
1050554336 9:6776254-6776276 GGAAAGAAAGATGTGTTGAGCGG - Intronic
1058767514 9:108196217-108196239 GGTAAAGCAGATGTGATGAGTGG + Intergenic
1059428122 9:114233816-114233838 GGAAAATCAAATGTCTTTAGGGG + Intronic
1061461594 9:130743912-130743934 TGTTAGGCAGATGTCTGGAGTGG + Intronic
1185809235 X:3089632-3089654 GGTAAGTCACAGGACTTAAGTGG + Exonic
1185912951 X:4002443-4002465 GCTAAATCAGATGTTTTGAGAGG - Intergenic
1188551615 X:31370771-31370793 GATAACTCAGATGTCTTCAAGGG + Intronic
1190305541 X:49079685-49079707 TCTAAGGCAGAGGTCTTGAGTGG - Intronic
1191779425 X:64849751-64849773 GCTAAGGCAGCTGTGTTGAGTGG - Intergenic
1192596025 X:72409165-72409187 CCTAAGTCAGAAATCTTGAGAGG + Intronic
1194026653 X:88761290-88761312 GATATGGCAGATGTCTTGGGTGG - Intergenic