ID: 981963612

View in Genome Browser
Species Human (GRCh38)
Location 4:150573878-150573900
Sequence CTTTTAACACAGTAGGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 227}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981963607_981963612 28 Left 981963607 4:150573827-150573849 CCTTTGTTTAGTGACTCATGTTT 0: 1
1: 0
2: 1
3: 36
4: 312
Right 981963612 4:150573878-150573900 CTTTTAACACAGTAGGAACTTGG 0: 1
1: 0
2: 0
3: 13
4: 227
981963609_981963612 -7 Left 981963609 4:150573862-150573884 CCCTGCTTAGATCTATCTTTTAA 0: 1
1: 0
2: 3
3: 29
4: 360
Right 981963612 4:150573878-150573900 CTTTTAACACAGTAGGAACTTGG 0: 1
1: 0
2: 0
3: 13
4: 227
981963610_981963612 -8 Left 981963610 4:150573863-150573885 CCTGCTTAGATCTATCTTTTAAC 0: 1
1: 0
2: 0
3: 30
4: 185
Right 981963612 4:150573878-150573900 CTTTTAACACAGTAGGAACTTGG 0: 1
1: 0
2: 0
3: 13
4: 227
981963608_981963612 -1 Left 981963608 4:150573856-150573878 CCACTTCCCTGCTTAGATCTATC 0: 1
1: 0
2: 1
3: 19
4: 254
Right 981963612 4:150573878-150573900 CTTTTAACACAGTAGGAACTTGG 0: 1
1: 0
2: 0
3: 13
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981963612 Original CRISPR CTTTTAACACAGTAGGAACT TGG Intronic
901092530 1:6651592-6651614 CTTTTCAAACAGTTGGAATTTGG - Exonic
902842393 1:19083308-19083330 CTTTTAACTCACAAGGAAATGGG + Intronic
906169385 1:43710957-43710979 CTTTGTACATAGTAGGTACTTGG + Intronic
906195023 1:43924795-43924817 ATTTTAACTCAGTAAGACCTAGG + Intronic
907071078 1:51535405-51535427 CTTTAAAGACAGAAGAAACTAGG - Intergenic
907094746 1:51767551-51767573 TTTTTAACACAGTACAAATTTGG + Intronic
907250427 1:53134430-53134452 CTGAAAACACAGTAAGAACTGGG + Intronic
907361733 1:53922086-53922108 CTTTTAAAAAATTAGAAACTGGG - Intronic
908154506 1:61338614-61338636 CTTCTAAGACAGAATGAACTCGG + Intronic
908777243 1:67652157-67652179 TTTTTAAAAAAGTAGGGACTTGG - Intergenic
909774899 1:79471585-79471607 GTTTTACCACAGTGAGAACTTGG + Intergenic
912102259 1:106224478-106224500 GACTTAACACAGTATGAACTTGG - Intergenic
912750263 1:112281725-112281747 TTTTTATGACAGTAGGGACTTGG - Intergenic
915318619 1:155043693-155043715 CTTTTAAGGCAGTGGGAACATGG - Intronic
917505260 1:175621538-175621560 CATTTAATACATTAGGAAATTGG - Intronic
919035281 1:192299658-192299680 CTTAAAACACAGTAGTAAATTGG - Intergenic
922067877 1:222161566-222161588 CTTTTATCATAGTATGAGCTGGG - Intergenic
923171280 1:231420380-231420402 GTTTCAAAACAGTAGGAACAGGG + Intronic
1065459091 10:25936853-25936875 CTTTAAGCACAGTAGGTACCTGG + Intronic
1067156322 10:43783904-43783926 CTTTTAACAAATGAGGACCTCGG + Intergenic
1067200960 10:44171798-44171820 CTTTAAGCAGAGTAGGGACTGGG + Intergenic
1073320758 10:102615010-102615032 CTTTTTACAGAGGAGGAACTGGG - Intronic
1074521526 10:114229319-114229341 GTTTTAACACAGTTGGCAGTTGG - Intronic
1077600265 11:3569739-3569761 CTATGAACACAGCAGGTACTAGG + Intergenic
1079994638 11:27282619-27282641 CATTTAAAATAGTAGGGACTTGG + Intergenic
1080894820 11:36440342-36440364 CTTTAAACACAGGAGGTACTAGG + Intronic
1081111191 11:39136070-39136092 CTTATAAGCCAGAAGGAACTGGG - Intergenic
1083057486 11:59836933-59836955 CTTTGCACATAGTAGGAGCTAGG + Intronic
1084256176 11:67944353-67944375 CTATAAACACAGCAGGTACTAGG + Intergenic
1084816585 11:71650946-71650968 CTATAAACACAGCAGGTACTAGG - Intergenic
1088002570 11:104900298-104900320 TTTTTACCACAATAGGAAATTGG - Intergenic
1089778017 11:120852642-120852664 CTTTGAAGACAGTAGCAGCTGGG - Intronic
1092426409 12:8379085-8379107 CTATAAACACAGCAGGTACTGGG + Intergenic
1092786988 12:12035813-12035835 GTTTTAAGACAGTGGGGACTTGG - Intergenic
1093285089 12:17249353-17249375 GTTTTAAAATGGTAGGAACTAGG - Intergenic
1095246758 12:39932357-39932379 CTTTTAAAAGATGAGGAACTAGG - Intronic
1101122539 12:101597984-101598006 TTCTTTACACAGTAGGAACCGGG - Intronic
1101152196 12:101893630-101893652 CATTTTACAAAGTAGGAAATTGG - Intronic
1101924948 12:108963839-108963861 TATTTAACACAGAAGGCACTGGG + Intronic
1107100206 13:36582201-36582223 CAGTAAATACAGTAGGAACTAGG - Intergenic
1107201237 13:37720740-37720762 CTGTTAACAAAATAGGAAATAGG - Intronic
1107326867 13:39253608-39253630 CTTAGCACACAGTAGGAACTTGG + Intergenic
1108220758 13:48231689-48231711 ATTTTAACACAGAACGAAGTAGG + Intergenic
1108313074 13:49214885-49214907 CTTTTTACACAGCAGGGACACGG - Intergenic
1108511084 13:51156340-51156362 CTTAGAACACAGTATGCACTTGG - Intergenic
1109844681 13:67971889-67971911 CTTTTAACACATAATGAGCTTGG + Intergenic
1111050510 13:82877690-82877712 CTATTAAGACAGTAGAAATTGGG - Intergenic
1111479073 13:88798437-88798459 TTTTTAACAAAATAGAAACTAGG - Intergenic
1112827700 13:103411104-103411126 CATTTAACATATTAGAAACTAGG - Intergenic
1115325755 14:32136032-32136054 CTTTTAATTCAGTGGGAGCTAGG + Intronic
1117540777 14:56744589-56744611 CTTTTAGGACAGTAGGAATGAGG - Intergenic
1118921605 14:70154096-70154118 CTTTTAACATAGGGGTAACTGGG - Intronic
1119780746 14:77275443-77275465 CTTATTTCTCAGTAGGAACTTGG - Exonic
1121211126 14:92208505-92208527 CACTGAAGACAGTAGGAACTAGG - Intergenic
1124452314 15:29806526-29806548 CTTTGCTCACAGAAGGAACTTGG - Intronic
1131100698 15:89687599-89687621 CTTACAAGACAGTAGGAACCAGG - Intronic
1131202143 15:90408185-90408207 CTTTTTACAAAGTAGGTGCTTGG + Intronic
1133371889 16:5251481-5251503 CTATAAACACAGCAGGTACTAGG - Intergenic
1133448349 16:5882064-5882086 CATTTTACAGAATAGGAACTAGG + Intergenic
1134213287 16:12295992-12296014 CATATTACATAGTAGGAACTGGG - Intronic
1134436381 16:14262286-14262308 CTATTAAAAAAGTAGGACCTTGG - Exonic
1136383597 16:29909082-29909104 CTTTTCACACAGTGGAAGCTAGG - Intronic
1138956219 16:61973490-61973512 CTTTTAACACTGCAGGAGTTAGG - Intronic
1139696868 16:68681249-68681271 CTTTTCACAGATTAGGAAATGGG - Intronic
1139721777 16:68861898-68861920 CTTTTAATTCATTTGGAACTTGG - Intronic
1143570353 17:7754222-7754244 CTTTTAATATTGTAGAAACTTGG + Intronic
1143924431 17:10357309-10357331 CTTCCAACTCAGTAGGGACTGGG - Intronic
1144052826 17:11511749-11511771 CTTTGCACACAGAAGGAACGTGG - Intronic
1152249919 17:79207122-79207144 CTTTTAACCCAGTAAGCATTTGG - Intronic
1153250959 18:3120805-3120827 CGTATCACTCAGTAGGAACTGGG + Intronic
1155579774 18:27290232-27290254 CTTTTCACACAGCATGTACTTGG - Intergenic
1155860840 18:30897386-30897408 CTGTTAACACAGTAGACAATTGG - Intergenic
1157734187 18:50032003-50032025 CTATTAACACAGTACAAAGTTGG - Intronic
1157773461 18:50371655-50371677 CTTGTAACACAGTACTCACTGGG - Intergenic
1158259773 18:55593666-55593688 ATTTTAACACAGGTGGGACTCGG - Intronic
1158699521 18:59733771-59733793 CTTCTAACACAGTCTGAACCTGG + Intergenic
1159498104 18:69232103-69232125 CTTTTTACAGAGTGGCAACTGGG - Intergenic
1164478392 19:28592571-28592593 CTTGGAAAACAGTAGGCACTCGG + Intergenic
1165728300 19:38127808-38127830 CCTTTAACACTGTTGCAACTCGG - Intronic
929210999 2:39357033-39357055 ATTATAACACAGTTGGAACAAGG - Intronic
930453452 2:51574722-51574744 ATTTTAATACAGTAAGCACTTGG + Intergenic
931002873 2:57808530-57808552 CTTTTAACCCAGGATAAACTTGG - Intergenic
931315088 2:61122068-61122090 CTTCTAAAACAATAGGAAGTTGG - Intronic
933384648 2:81594693-81594715 CTTTTAATACAATAATAACTAGG - Intergenic
934513021 2:94963308-94963330 GTTTCAACACATTAGGAATTTGG + Intergenic
934956731 2:98628698-98628720 CTTTTAACACTGTAGAATGTGGG - Intronic
936434614 2:112493445-112493467 CATTTCACAAATTAGGAACTGGG - Intronic
939282869 2:140087933-140087955 CTTGGAACACAACAGGAACTGGG + Intergenic
940849858 2:158678030-158678052 GTTTTAATACAAAAGGAACTTGG - Intronic
942222400 2:173783278-173783300 CTTTTAACATCAAAGGAACTTGG - Intergenic
943604441 2:189960511-189960533 CTTTTAACACAGTGATTACTAGG + Intronic
945040170 2:205737405-205737427 CATTTAACAGAGGAGGAAATTGG + Intronic
948316110 2:237029753-237029775 CTCTTAACACAGTAAAAAATGGG + Intergenic
1171064608 20:22002324-22002346 CTTGCAACACAGAAGGATCTCGG - Intergenic
1173162558 20:40663544-40663566 CTTTGAAAACAGTATGAAGTAGG - Intergenic
1175165150 20:57038322-57038344 CTTGGCACACAGTAGGAGCTCGG - Intergenic
1175765073 20:61586898-61586920 CTTAGTACACAGTAGGTACTCGG - Intronic
1176955053 21:15092810-15092832 CTTTTTACATAGTTGGAAGTGGG - Intergenic
1177718640 21:24874946-24874968 TTTTTAAAGCTGTAGGAACTGGG + Intergenic
1178022354 21:28423589-28423611 CTTTTAACAGTGTTGAAACTGGG - Intergenic
1178872381 21:36387083-36387105 CTTGTTACCCAGTAGGAACCAGG - Intronic
1182288127 22:29259972-29259994 CTTTAGACAGAGTAGGAGCTCGG + Exonic
1182572049 22:31246841-31246863 CATTTAACAGATTAGGAAATAGG - Intronic
1184513406 22:44946004-44946026 CTTGGCACACTGTAGGAACTTGG - Intronic
949256920 3:2059646-2059668 CCTTTAACAAGGAAGGAACTAGG + Intergenic
950909449 3:16573482-16573504 CTTTTTATATAGTATGAACTAGG - Intergenic
951077030 3:18406936-18406958 CCTGACACACAGTAGGAACTCGG - Intronic
952609671 3:35193072-35193094 CTTTTTACACAGTAGGTATGGGG - Intergenic
953985891 3:47442754-47442776 CTTTTTACACAATGGGAGCTTGG - Intronic
954842528 3:53524544-53524566 CTTTTAAGTTAGTAGGAACAGGG + Intronic
957071093 3:75568390-75568412 CTATAAACACAGCAGGTACTAGG + Intergenic
960008055 3:112801881-112801903 CTTGTAACTCAGTAGGAAGGTGG - Intronic
960194712 3:114751071-114751093 TTTGACACACAGTAGGAACTTGG - Intronic
960219589 3:115089567-115089589 CATTTAACACAATGGGAACCTGG + Intronic
961395520 3:126585669-126585691 CTTTGAAAACATTGGGAACTTGG + Intronic
962188676 3:133287330-133287352 CTATTAACCCAGTAAAAACTGGG + Intronic
962596387 3:136949522-136949544 TTTTTAACCAAGTAGGAATTTGG + Intronic
962753835 3:138453397-138453419 CTTTAAACTCAGGAGGCACTTGG + Intronic
964323641 3:155523816-155523838 CCTCCAACACAGTAGCAACTTGG + Intronic
965636243 3:170784174-170784196 CTATTATCTCAGAAGGAACTTGG + Intronic
966760414 3:183413160-183413182 CTTTGAACAATGTAGGAGCTGGG + Intronic
966862440 3:184237957-184237979 CACTTGACACAGTAGGAGCTGGG + Intronic
967457894 3:189710918-189710940 CTGTTAAAACTCTAGGAACTTGG - Intronic
968032732 3:195515584-195515606 CTTCTAACGCAGTAAGAATTAGG - Exonic
968496583 4:920841-920863 CTTTTAACAAAATAGTATCTGGG - Intronic
969014693 4:4096087-4096109 CTATAAACACAGCAGGTACTAGG + Intergenic
969739248 4:9012353-9012375 CTATAAACACAGCAGGTACTAGG - Intergenic
969798432 4:9543866-9543888 CTATAAACACAGCAGGTACTAGG - Intergenic
970455825 4:16223538-16223560 CTTTTAACATAGTTAGAATTGGG - Intronic
970787958 4:19822337-19822359 TTTTTAATGCAGTATGAACTTGG - Intergenic
971498776 4:27296347-27296369 CTTTTAACACAGAAGAGATTGGG - Intergenic
972953719 4:44362744-44362766 CCTTTAACACAGAAGAAACTAGG - Intronic
973297155 4:48536947-48536969 CTATTAACACAGTAGTACCTGGG + Intronic
973342876 4:49024254-49024276 TTTTGAAGACAGCAGGAACTTGG + Intronic
973642489 4:52917283-52917305 CTTCTTACAGAGTAGGAACCAGG + Intronic
974229420 4:59091384-59091406 CCGTTAACTCAGTAGGAAGTGGG - Intergenic
974634012 4:64535049-64535071 CTTTAAAGACAGTAGAAAATTGG + Intergenic
976043754 4:80919820-80919842 CTTTTGACACATGAGGGACTTGG - Intronic
976419050 4:84817244-84817266 CTTTGTACACGTTAGGAACTTGG - Intronic
980177921 4:129369116-129369138 ATTTTAAGACAGTAGAATCTAGG - Intergenic
981963612 4:150573878-150573900 CTTTTAACACAGTAGGAACTTGG + Intronic
986262534 5:6160769-6160791 CTTTTAAAACAGAAGGAAAGTGG + Intergenic
987029840 5:13965684-13965706 CTGTTAATTCAGGAGGAACTGGG - Intergenic
987693708 5:21301320-21301342 CATTTAACACAACAGGAAATAGG - Intergenic
988272949 5:29040992-29041014 CATTGAACAAAGTAAGAACTCGG - Intergenic
989110148 5:37899372-37899394 ATTTTAAGACATTAGGAACCAGG + Intergenic
990003157 5:50918754-50918776 ATTTTAACATAGGAGGAAATTGG + Intergenic
990273108 5:54167062-54167084 CTTATAACTCACAAGGAACTGGG - Intronic
991157824 5:63459222-63459244 CTATTAAGTCAGTAGCAACTTGG + Intergenic
991455301 5:66797142-66797164 ATTTTAACAAAGGAGGAAATAGG - Intronic
991746554 5:69748220-69748242 CATTTAACACAACAGGAAATAGG + Intergenic
991751151 5:69807022-69807044 CATTTAACACAACAGGAAATAGG - Intergenic
991798154 5:70328163-70328185 CATTTAACACAACAGGAAATAGG + Intergenic
991825932 5:70623532-70623554 CATTTAACACAACAGGAAATAGG + Intergenic
991830440 5:70681917-70681939 CATTTAACACAACAGGAAATAGG - Intergenic
991890498 5:71327485-71327507 CATTTAACACAACAGGAAATAGG + Intergenic
992567413 5:78012640-78012662 CTTTTGACCCTGTAGTAACTTGG + Intronic
993207844 5:84907815-84907837 CTTTTAAAACAGTAGTTCCTAGG - Intergenic
993600012 5:89910789-89910811 CTTTTAACACACATAGAACTAGG - Intergenic
993914114 5:93720832-93720854 CTTTTAACAAAGTAAAAAGTAGG - Intronic
995434956 5:112124973-112124995 ATTGTAAAACAGTAGGAAATGGG + Intergenic
996041625 5:118820340-118820362 CTTTTAACACAGTTTCAATTAGG + Intergenic
997418055 5:133744370-133744392 CTTATCACACAGCAGGAGCTGGG - Intergenic
998483803 5:142484721-142484743 CTTTAAACAGAGTAGGCACTTGG - Intergenic
999417513 5:151411887-151411909 TATTTAAAATAGTAGGAACTTGG - Intergenic
999417685 5:151414037-151414059 CTTATAACAAAGTAAGTACTTGG - Intergenic
1000347652 5:160328251-160328273 TTTTAAACACAGGAGGAACAGGG + Intronic
1002183753 5:177444403-177444425 CTCTTAACACAGTGGGTCCTTGG + Intergenic
1002970868 6:2017620-2017642 CTTTTAACAACATAGGAATTAGG + Intronic
1003298886 6:4858813-4858835 CTTTTTCCAGAGGAGGAACTGGG - Intronic
1003521847 6:6864952-6864974 CTTGCAACACAGTAGGTAATAGG + Intergenic
1004418157 6:15444239-15444261 CGTTTAAAACTGTGGGAACTGGG + Intronic
1004721745 6:18273692-18273714 CTTTTAACATGGTAGGAAATTGG + Intergenic
1005272147 6:24177804-24177826 CATTCAACACATTAGGCACTTGG - Intronic
1005281221 6:24276696-24276718 CTTGTCACACAATAGGCACTCGG + Intronic
1005398224 6:25405621-25405643 CTTTGAACACAGTAGGCAAAAGG + Intronic
1005460321 6:26063019-26063041 CATTTTACAGAGAAGGAACTTGG - Intergenic
1006172114 6:32099178-32099200 CTTAGAAGACAGTAGGAGCTGGG - Intronic
1006646968 6:35521528-35521550 CTGTTAACACAGAGGGAAGTAGG - Intergenic
1009426185 6:63515832-63515854 CATATAACACATTATGAACTAGG - Intergenic
1010021082 6:71160749-71160771 ATTTTAAGACAGTATGAATTTGG + Intergenic
1010569313 6:77458829-77458851 CTTAAAATACAGGAGGAACTGGG - Intergenic
1010671444 6:78691479-78691501 CTTTGAAAACAGTCAGAACTGGG - Intergenic
1010685249 6:78846918-78846940 TTTTTACCACAGCAGAAACTTGG - Intergenic
1010847662 6:80730226-80730248 CTTTTAATTCAGTAGGATTTTGG + Intergenic
1011803183 6:91041865-91041887 TTTTTCTCACAGTAGGAACCTGG + Intergenic
1012269676 6:97193530-97193552 TTTATAACACAGTAGTAACAAGG + Intronic
1013879040 6:114871486-114871508 ATTTTAACACAGTAGTAATGAGG - Intergenic
1015318099 6:131840390-131840412 CATTTAAGAAAATAGGAACTAGG + Intronic
1016104100 6:140140470-140140492 TTTTAAGCACAGTAGGAATTGGG + Intergenic
1017437829 6:154434162-154434184 CTTGGAACACTGTATGAACTGGG + Intronic
1021249255 7:18304108-18304130 CATGTAACACAGGAGGAACCTGG - Intronic
1021375289 7:19899568-19899590 CTTTACACACTGTGGGAACTGGG + Intergenic
1021608801 7:22436078-22436100 CATTTTACACAGTAGGAACAAGG - Intronic
1021757330 7:23865434-23865456 CTTTAAACACACTATGAAATAGG - Intergenic
1021906865 7:25343247-25343269 ATTTTAAATCAGAAGGAACTAGG + Intergenic
1023562163 7:41487579-41487601 ATTTCAATACGGTAGGAACTAGG + Intergenic
1023936713 7:44745696-44745718 CTGTTAACACTTAAGGAACTGGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1027903038 7:84142682-84142704 GTTTTTACACAGTAATAACTTGG + Intronic
1028740389 7:94267989-94268011 TTTTTTACCCATTAGGAACTAGG - Intergenic
1029073365 7:97917717-97917739 CTATAAACACAGCAGGTACTAGG + Intergenic
1029212774 7:98922400-98922422 CTTTTTACACAGTAAAAACGAGG - Intronic
1030045164 7:105488837-105488859 TTTTCAACACAGAAAGAACTAGG - Intronic
1030281484 7:107780270-107780292 CATTTAACATAGTAGGTTCTGGG - Intronic
1031952681 7:127908488-127908510 TTTTTCACAGAGTAGGAACTGGG + Intronic
1032809382 7:135395437-135395459 CTTTTAACACAGTAATTTCTAGG + Intronic
1033006409 7:137569284-137569306 CTTCTACCACAGTCAGAACTAGG + Intronic
1034747675 7:153537348-153537370 CTTTTTAAACAGTAGGACCTGGG - Intergenic
1036256420 8:7210166-7210188 CTATAAACACAGCAGGTACTAGG + Intergenic
1036308470 8:7668751-7668773 CTATAAACACAGCAGGTACTAGG + Intergenic
1036361064 8:8077326-8077348 CTATAAACACAGCAGGTACTAGG - Intergenic
1036889899 8:12589675-12589697 CTATAAACACAGCAGGTACTAGG + Intergenic
1036897506 8:12647836-12647858 CTATAAACACAGCAGGTACTAGG + Intergenic
1037822701 8:22142643-22142665 CTTTTAACCATGTAGGAAATAGG + Intergenic
1038131819 8:24740608-24740630 CTTTTAGCACTTTAGGTACTGGG - Intergenic
1038157859 8:25007764-25007786 CTTCCAACACAGAGGGAACTTGG - Intergenic
1038295037 8:26283874-26283896 CCTAGAACATAGTAGGAACTTGG - Intergenic
1038385295 8:27138971-27138993 CTATTTACAAAATAGGAACTTGG + Intergenic
1038719119 8:30017471-30017493 GACTTAACAGAGTAGGAACTTGG + Intergenic
1039706152 8:40009570-40009592 CTTTTTTCACAGTAGCAGCTTGG + Intronic
1041026002 8:53687704-53687726 CTTTTTAGACATTAGGAAATGGG - Intergenic
1042243275 8:66686291-66686313 CTTTTAATGTAGTAAGAACTAGG + Intronic
1044245682 8:89942149-89942171 CTTACAACACAGAAGGAGCTAGG + Intronic
1045645595 8:104294028-104294050 CTTGTAACAAAGTAGGAGCTTGG - Intergenic
1045983851 8:108224301-108224323 CTTATAGCACAGTAGGTAGTTGG - Intronic
1047811214 8:128411120-128411142 CTTTTACAACTGAAGGAACTAGG + Intergenic
1051759734 9:20448945-20448967 CCTAGAACACAGTAGGTACTGGG - Intronic
1051817095 9:21121074-21121096 CTTGGAACCCAGGAGGAACTAGG - Intergenic
1053053979 9:34982930-34982952 CTTTTAGCTCAGGAGGAACTGGG - Intergenic
1056214720 9:84396430-84396452 CTTTTAACATAATGGTAACTTGG - Intergenic
1057515366 9:95715913-95715935 ATTTTCACAAAGAAGGAACTCGG + Intergenic
1058047654 9:100373814-100373836 ATCTTCACACAGTAGTAACTTGG - Intergenic
1058635575 9:107035183-107035205 TTTTTAACCCAGTATGAACGAGG - Intergenic
1186224940 X:7388441-7388463 CTTTTAGCAGGGTAGGTACTAGG + Intergenic
1187257894 X:17657889-17657911 CTATGAACACAGTAGGAAGTTGG - Intronic
1188823660 X:34803793-34803815 CCTTTAACAAATAAGGAACTGGG - Intergenic
1191131815 X:57021878-57021900 CTTGTAACATAGTTGGAAGTTGG + Intergenic
1192797077 X:74432848-74432870 CTTTTCACAAAGTAGGGCCTGGG - Intronic
1199719184 X:150530079-150530101 TTTTTCACACAGGAGGAAGTTGG + Intergenic
1201594500 Y:15652606-15652628 CTTTTAGCAGGGTAGGTACTAGG + Intergenic