ID: 981963970

View in Genome Browser
Species Human (GRCh38)
Location 4:150579656-150579678
Sequence CTCCGCTGCACCTCCACTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 119}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981963970_981963978 16 Left 981963970 4:150579656-150579678 CCGCCAGTGGAGGTGCAGCGGAG 0: 1
1: 0
2: 0
3: 14
4: 119
Right 981963978 4:150579695-150579717 GCGCGAAGGTCCGCTCGGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 48
981963970_981963977 11 Left 981963970 4:150579656-150579678 CCGCCAGTGGAGGTGCAGCGGAG 0: 1
1: 0
2: 0
3: 14
4: 119
Right 981963977 4:150579690-150579712 TGGTGGCGCGAAGGTCCGCTCGG 0: 1
1: 0
2: 0
3: 2
4: 40
981963970_981963979 17 Left 981963970 4:150579656-150579678 CCGCCAGTGGAGGTGCAGCGGAG 0: 1
1: 0
2: 0
3: 14
4: 119
Right 981963979 4:150579696-150579718 CGCGAAGGTCCGCTCGGCCTGGG No data
981963970_981963974 -6 Left 981963970 4:150579656-150579678 CCGCCAGTGGAGGTGCAGCGGAG 0: 1
1: 0
2: 0
3: 14
4: 119
Right 981963974 4:150579673-150579695 GCGGAGTGTCCGGCGAGTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 59
981963970_981963973 -9 Left 981963970 4:150579656-150579678 CCGCCAGTGGAGGTGCAGCGGAG 0: 1
1: 0
2: 0
3: 14
4: 119
Right 981963973 4:150579670-150579692 GCAGCGGAGTGTCCGGCGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 67
981963970_981963975 2 Left 981963970 4:150579656-150579678 CCGCCAGTGGAGGTGCAGCGGAG 0: 1
1: 0
2: 0
3: 14
4: 119
Right 981963975 4:150579681-150579703 TCCGGCGAGTGGTGGCGCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981963970 Original CRISPR CTCCGCTGCACCTCCACTGG CGG (reversed) Intronic
901641954 1:10697093-10697115 GACCGCTGCTCCTCCACTGAAGG - Intronic
902080304 1:13816098-13816120 CTCACCTGCATGTCCACTGGGGG + Intronic
913598640 1:120402643-120402665 CTACGTTGCATCACCACTGGAGG - Intergenic
914088741 1:144476975-144476997 CTACGTTGCATCACCACTGGAGG + Intergenic
914309871 1:146457228-146457250 CTACGTTGCATCACCACTGGAGG - Intergenic
914511841 1:148339504-148339526 CTACGTTGCATCACCACTGGAGG + Intergenic
914592238 1:149115905-149115927 CTACGTTGCATCACCACTGGAGG + Intergenic
915699791 1:157781027-157781049 TTCCCCTCCACCTCCACTGTAGG - Intergenic
915930201 1:160055775-160055797 CTCCTCTGCACCTTAACTGTTGG + Intronic
917096685 1:171405169-171405191 CTCTGCTGCACCACCTCTTGTGG - Intergenic
921646967 1:217630834-217630856 CTCCGCTGGACCTGGAATGGAGG - Intronic
924285080 1:242477539-242477561 CTCCCCTGCGCCTCAACTGCGGG - Intronic
924807362 1:247372162-247372184 CTCCGCAGCACCTGCACGGCTGG - Intergenic
1062824021 10:555827-555849 CTCCGTTCCACCCCCACGGGAGG + Intronic
1065838452 10:29680280-29680302 GTCATATGCACCTCCACTGGTGG - Intronic
1077024851 11:434585-434607 CTCGTCTGCACCTCCAGGGGTGG - Intronic
1083202030 11:61126472-61126494 CTCGGCCGCCCCTCCACTTGTGG + Exonic
1083818348 11:65150801-65150823 CTGCGCTGCACCTCCAGTGAGGG + Intergenic
1083967443 11:66051418-66051440 CTCAGCCGCACCTGCACTGGGGG - Intronic
1084572197 11:69966487-69966509 CGACGCAGCACCTCCACTGCTGG - Intergenic
1084694798 11:70746799-70746821 CCCCGCTGCCCCCACACTGGGGG + Intronic
1088428315 11:109729534-109729556 CTCTGCTGCTCCTCCACCAGTGG - Intergenic
1091356606 11:134942332-134942354 CTCCGCTGCACCCAGCCTGGTGG - Intergenic
1092132558 12:6122992-6123014 CTCCGCAGAACCTTCACAGGAGG + Intronic
1092579233 12:9820765-9820787 CACCGCTGCAACTGCAGTGGTGG - Intergenic
1096228968 12:49887090-49887112 CACCGCTGCCCCTCCCCTGGAGG + Intronic
1099171177 12:79366555-79366577 CTGAGTTGCAACTCCACTGGAGG - Intronic
1107730745 13:43345915-43345937 CTCCGATGCCCCTCCAGTGGAGG - Intronic
1111863988 13:93744987-93745009 CTCCTCTCCACCTCCACAGTGGG + Intronic
1118822403 14:69353907-69353929 GTCCGCAGCACCTGCTCTGGAGG + Exonic
1122059222 14:99125385-99125407 CACTGCTGCCCCTCCACCGGAGG + Intergenic
1123165081 14:106318871-106318893 CTCCGGTGCACCTGCTCTGGGGG + Intergenic
1126790175 15:52213818-52213840 CCCCGCTGCATCCCCACTGCTGG - Intronic
1127901653 15:63345537-63345559 CGCAGCTGCACCTGCACTGGGGG - Exonic
1129238895 15:74240233-74240255 CTCCCCTGCACCTCCCCTCGGGG - Intronic
1132378418 15:101348185-101348207 CTCCGCTGCTCCTCCCCGGTGGG + Intronic
1132543753 16:523633-523655 TTCTGCTGCACCTGCACTGAGGG - Intergenic
1133119291 16:3596296-3596318 CTCCACGGCACCCCCACTGCAGG - Exonic
1133718201 16:8469531-8469553 CCATGCTGCACCTTCACTGGAGG - Intergenic
1141421688 16:83921792-83921814 CTCCTCTGCACTGCCACTGTGGG - Exonic
1141460949 16:84178630-84178652 CTCCGCTGCGCCTCAGCTGTGGG - Exonic
1141675265 16:85514268-85514290 CTCCCCTGAATCTCAACTGGAGG - Intergenic
1142496736 17:310004-310026 CTCCCCTGCACCCACACTGTGGG + Intronic
1143031945 17:3972875-3972897 CTCCCCTGCCCCTCCCCTGAGGG - Intergenic
1147577225 17:41609813-41609835 CTCCCCTGCTCCTCTGCTGGTGG - Exonic
1147820039 17:43235982-43236004 CTCCGCTCCACCACCTCTTGTGG + Intergenic
1147821353 17:43243381-43243403 CTCCGCTCCACCACCTCTTGTGG + Intergenic
1147823074 17:43253310-43253332 CTCCGCTCCACCACCTCTTGTGG + Intergenic
1147823844 17:43257910-43257932 CTCCGCTCCACCACCTCTTGTGG + Intergenic
1147824603 17:43262350-43262372 CTCCGCTCCACCACCTCTTGTGG + Intergenic
1147827779 17:43280174-43280196 CTCCGCTCCACCACCTCTTGTGG + Intergenic
1147828887 17:43286335-43286357 CTCCGCTCCACCACCTCTTGTGG + Intergenic
1147829982 17:43292478-43292500 CTCCGCTCCACCACCTCTTGTGG + Intergenic
1147834990 17:43323661-43323683 CTCCGCTCCACCACCTCTTGTGG - Intergenic
1152246155 17:79185573-79185595 CCCTGCTGCACCTTCCCTGGAGG + Intronic
1152688471 17:81706797-81706819 CTCCGCTGCACCTCCCTTTGGGG + Intronic
1160148520 18:76383182-76383204 GCCCGCTGCCCCTCCACTCGTGG - Intronic
1160809488 19:1007296-1007318 CTCCTCTGCCTCTCCCCTGGGGG - Intronic
1162063472 19:8110880-8110902 TTCCGCTGCATCTGCAATGGTGG - Exonic
1165841975 19:38793564-38793586 CTCCGCCGCACCCACACTGTGGG + Intergenic
1167697510 19:51024030-51024052 CTCTGGTGCTCCTACACTGGGGG + Exonic
925354079 2:3224897-3224919 CACCGGAGCTCCTCCACTGGGGG + Intronic
927713614 2:25340292-25340314 CTCCGCTGCACGGCCAGTTGAGG - Intronic
935503326 2:103869000-103869022 CCCCGCTCCACTTCCACTGGGGG + Intergenic
938067129 2:128287292-128287314 CTCACCTGCACCTTCTCTGGGGG - Intronic
944427309 2:199596749-199596771 CTCCTTTGCACTTCCACTAGAGG - Intergenic
944716261 2:202377652-202377674 CTCCGCTGCACCGCGATCGGGGG - Intronic
946313973 2:218897570-218897592 CTGGGCTGCAACTCCACTGGGGG - Intronic
1172002277 20:31788585-31788607 TTCCTCTGCACTTCCACTTGTGG + Intronic
1172765360 20:37347880-37347902 CTCCACTGCCCCATCACTGGAGG - Intronic
1172922745 20:38499584-38499606 CTCCACTGCTCCACCACTGCTGG - Exonic
1173174615 20:40754911-40754933 TGCACCTGCACCTCCACTGGGGG - Intergenic
1173399838 20:42715008-42715030 CTCAACTGCAACTCCACTGCAGG - Intronic
1173672706 20:44809760-44809782 CTGCGCGCCACCTCCAATGGCGG + Intronic
1174396440 20:50249942-50249964 CTGGGCGGCACCTCCTCTGGAGG + Intergenic
1175545131 20:59773164-59773186 CTCCCCTGCACCTCCAGGAGGGG - Intronic
1176414046 21:6464793-6464815 ATCTGCTGCCCCTCCTCTGGGGG + Intergenic
1179516847 21:41914480-41914502 TCCCGCTGCACCCCCACGGGAGG + Intronic
1179583943 21:42363118-42363140 CCCCATTGCACCACCACTGGCGG + Intronic
1179627596 21:42657493-42657515 CTCAGCTGCCCCTACCCTGGGGG + Intronic
1179689544 21:43073115-43073137 ATCTGCTGCCCCTCCTCTGGGGG + Intronic
1180673246 22:17569720-17569742 CCACGCTGCACCTCCCCAGGTGG - Intronic
1181748702 22:24973996-24974018 CCCAGCTGCACCTCCTTTGGTGG + Intronic
1182667067 22:31967699-31967721 CTCCTCTGCACCCTCAATGGTGG - Intergenic
1184815057 22:46862767-46862789 CTCAGCTGCACCTCCCAGGGTGG - Intronic
1184961762 22:47934250-47934272 CTCCTCTGAAGCTCCTCTGGTGG - Intergenic
950452227 3:13071946-13071968 CTCCCCGTCACCTCCACTGAGGG - Intronic
950865018 3:16181941-16181963 CTACGCTGCAACCCCACTGCGGG - Intronic
955996588 3:64685887-64685909 CTGCGCTGCACCCCCACTCTCGG + Intronic
960541403 3:118865959-118865981 CTAGGCTGCACTTCCACTTGAGG - Intergenic
966793542 3:183694229-183694251 CTCACCTGCACAGCCACTGGAGG - Intergenic
967364615 3:188671787-188671809 GTCTCCTGCACCTCCACTGAGGG - Intronic
967449434 3:189606634-189606656 CTCCGTTGCACCACCACAGCTGG + Intergenic
967480134 3:189963152-189963174 TACCGCTGCAGCTCCACAGGTGG + Intronic
968040297 3:195583116-195583138 CTCCACAGCACCTCCTCTGGAGG + Intronic
968800934 4:2742907-2742929 CTACTCTGCACCTCCTCTGTGGG + Intronic
969293406 4:6254913-6254935 CTCTGCCACTCCTCCACTGGGGG - Intergenic
977932258 4:102761420-102761442 CCCCGCTGCAGCTCAACTCGCGG + Intergenic
981562553 4:146063621-146063643 GGCTGCTGCAACTCCACTGGTGG - Intergenic
981963970 4:150579656-150579678 CTCCGCTGCACCTCCACTGGCGG - Intronic
986253221 5:6080209-6080231 CTCGGCTACACCTGCACTCGTGG + Intergenic
992551545 5:77865082-77865104 GTAGGCTGCTCCTCCACTGGAGG - Intronic
996403487 5:123086657-123086679 CTCCCCTGCACCTCCCCAGCAGG - Intergenic
996727683 5:126686955-126686977 CTCAGCTGCAACTGCACTGTGGG - Intergenic
999619596 5:153459234-153459256 CTCTACTGCTCCTCCCCTGGAGG + Intergenic
1002484052 5:179522882-179522904 CTCCCGTGCACCTCCACAGATGG - Intergenic
1002500513 5:179644599-179644621 CTCCCGTGCACCTCCACAGATGG + Intronic
1002884927 6:1285127-1285149 CTCAGCTGCACTTGCACTGGGGG - Intergenic
1003604418 6:7546043-7546065 CTTCCCTGCTCCTCCAATGGAGG - Intronic
1003608804 6:7590273-7590295 CGCCGCCGCTCCTCCACAGGTGG - Exonic
1011029800 6:82909483-82909505 CTCTGCAGCATCTCCTCTGGAGG - Intronic
1018231796 6:161682534-161682556 CCCCGCAGCCCCTCCACAGGAGG - Intronic
1019301294 7:305355-305377 ATCCCCAGCACCTCTACTGGAGG - Intergenic
1026099378 7:67372037-67372059 CCCCTCTGCACCTGGACTGGTGG - Intergenic
1029550399 7:101234340-101234362 CTGCGCTGCACCAACATTGGGGG - Exonic
1033236279 7:139640375-139640397 AGCCTCTACACCTCCACTGGAGG - Intronic
1033791332 7:144795673-144795695 CTCTGCTGCACAGCCATTGGGGG - Intronic
1036553872 8:9839546-9839568 CTCTGCTGCACATCTGCTGGAGG - Intergenic
1037127165 8:15365442-15365464 CTCCACTGCACTTTCACTGTAGG - Intergenic
1037443453 8:18940922-18940944 CTCAGCTCCACCTGCACTGGGGG + Intronic
1045375999 8:101574648-101574670 CTGCGCCCCACCTGCACTGGCGG - Intronic
1047221396 8:122921465-122921487 CGCTGCTGCCCCTCCCCTGGGGG + Intronic
1048174048 8:132135458-132135480 CCCAGCTGCTCCTCCACTGACGG + Intronic
1049424623 8:142532606-142532628 CTCCTCTGCTCCTCCCCTGCTGG + Intronic
1049642533 8:143722022-143722044 CTCCACTGCACCCCCTCTGATGG + Intronic
1049928555 9:433388-433410 CTCCCCTGGACCTCCACTGTTGG + Intronic
1051004709 9:12329390-12329412 CTCCGCTCCACCACCTCTTGTGG - Intergenic
1057605729 9:96496710-96496732 GTCCGCTGCACCTCCTCCAGCGG - Intronic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1058318435 9:103599030-103599052 CTGCTCTGCCACTCCACTGGTGG - Intergenic
1186450715 X:9671268-9671290 CTTCTCTGTAACTCCACTGGGGG - Intronic
1195221513 X:102748694-102748716 CTCAGGTCCATCTCCACTGGTGG + Exonic
1198296882 X:135295873-135295895 CTCCGCTGCTGCACCACTAGGGG + Exonic
1200093897 X:153648319-153648341 CCCCGCGGCACCTACCCTGGAGG - Exonic