ID: 981968054

View in Genome Browser
Species Human (GRCh38)
Location 4:150630478-150630500
Sequence ACTGATATTCAGACTGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 274}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981968054 Original CRISPR ACTGATATTCAGACTGAATA AGG (reversed) Intronic
901892257 1:12276822-12276844 ACTGATATTCCAACTTAATAAGG - Exonic
902948068 1:19857902-19857924 TCTGATATTCAGATTTAATTGGG - Intergenic
905781385 1:40713312-40713334 AATCATATTCAGACAGAATGAGG + Intronic
908150463 1:61295921-61295943 ACTCATTTTCAGGTTGAATATGG + Intronic
908890390 1:68840315-68840337 ACTAATATTCAGAATCTATAAGG - Intergenic
909250568 1:73348980-73349002 ACTCATATCCAGAGTGATTATGG + Intergenic
909981713 1:82110067-82110089 ACTAATAATCAGAAAGAATATGG + Intergenic
911330646 1:96522082-96522104 ACTGATGGTCTGACTGAGTAAGG + Intergenic
911925504 1:103825751-103825773 ACTAATATTCAGAATATATAAGG + Intergenic
912139689 1:106708202-106708224 TCTGATATCCAGACTCTATAGGG - Intergenic
912301718 1:108524626-108524648 ACTGATATCCAGAATCTATAAGG - Intergenic
913373475 1:118126563-118126585 ACTAATATTCAGAATATATAAGG - Intronic
913377619 1:118171157-118171179 ACTTAGAGGCAGACTGAATATGG + Intronic
913663596 1:121027489-121027511 ACTAATATCCAGACTCTATAAGG + Intergenic
914014994 1:143810771-143810793 ACTAATATCCAGACTCTATAAGG + Intergenic
914162828 1:145150454-145150476 ACTAATATCCAGACTCTATAAGG - Intergenic
914653612 1:149719310-149719332 ACTAATATCCAGACTCTATAAGG + Intergenic
916633714 1:166644912-166644934 ACTAATATTCAGACTATACAAGG + Intergenic
917098575 1:171423995-171424017 ACTAATATTGAGACAGAGTAGGG - Intergenic
918564131 1:185906855-185906877 CCTGATATGGAGACTGAAGAGGG - Intronic
918897281 1:190364127-190364149 AATAATATTCAGACTGATTCTGG + Intronic
920042365 1:203109785-203109807 ACTGATATCCAGAATCTATAAGG + Intronic
920851551 1:209631564-209631586 CCTGAGATTCAGAGTGAATTGGG - Intronic
921774864 1:219085688-219085710 ACTGATATTCCACCTGAATTGGG - Intergenic
921965220 1:221080791-221080813 ACTGATGTTTATACTGTATAAGG - Intergenic
923084514 1:230693240-230693262 ACTGCAATTCAAGCTGAATATGG - Intronic
924759889 1:246973902-246973924 ACTGACATTCACACATAATAGGG - Intronic
924769226 1:247064357-247064379 ACTGAGCTTCTGACTGGATAGGG + Intronic
1063311319 10:4955350-4955372 ACTGATATCCAGAATTTATAAGG - Intronic
1063818317 10:9803722-9803744 ACTGATGTGCAAACTGATTATGG + Intergenic
1065696313 10:28383661-28383683 ACTGAAATTCAGAGAGAATAAGG + Intergenic
1065808631 10:29420168-29420190 ACTGAGCAGCAGACTGAATACGG - Intergenic
1066119613 10:32272242-32272264 ACTTATATTCAAACTGATTTTGG - Intronic
1067672728 10:48339676-48339698 ACTGATATCCATAATAAATAAGG + Intronic
1068728292 10:60327236-60327258 ACTGATATTCAGGGTGCACATGG + Intronic
1069965549 10:72112229-72112251 AATAATATTCAGCCTTAATAAGG + Intronic
1072350115 10:94549012-94549034 ACTTATATTAAGATTGAAAACGG - Intronic
1073827711 10:107344464-107344486 ACTGATATCCAGAATGTATAAGG - Intergenic
1074331291 10:112512429-112512451 ACTAATATTCAGAATATATAAGG - Intronic
1074662170 10:115673021-115673043 ACTGATTTTAGGAATGAATATGG + Intronic
1074972760 10:118553019-118553041 ACTGGTATCCAGAGTGTATAAGG - Intergenic
1077513939 11:2990065-2990087 ACTGTTTTTCAAAATGAATATGG - Intronic
1078918280 11:15801511-15801533 ACAGATATTCAGAGTGTTTAGGG + Intergenic
1081120867 11:39263887-39263909 TCTGATATTAAGATTGAATTAGG + Intergenic
1083286777 11:61664833-61664855 AATGTTATTCAGACTTAAAAAGG + Intergenic
1083510107 11:63201770-63201792 TCTGATATTCAGAATCTATAAGG + Intronic
1085194967 11:74664601-74664623 ACTAATATTCCTAATGAATATGG + Intronic
1087470083 11:98562153-98562175 ACATATATTGACACTGAATAAGG - Intergenic
1087692987 11:101343516-101343538 ACTAATATTCAGAATCTATAAGG - Intergenic
1089939568 11:122401511-122401533 TCTAATATTCAGAGTCAATAAGG + Intergenic
1090700894 11:129294580-129294602 TCTGATATACAGACTGAAATAGG + Intergenic
1091199846 11:133768418-133768440 ACTGATATTCCTCATGAATATGG + Intergenic
1092898689 12:13038310-13038332 ACAGATATTCAAATTTAATATGG + Intergenic
1093066084 12:14659715-14659737 ACTGTCATTCATACTGAATTAGG + Intronic
1093791098 12:23251162-23251184 AATGATATTCAAGCTGAAAATGG + Intergenic
1093902829 12:24655279-24655301 ACTAATAATCAGAATGTATAAGG - Intergenic
1094276879 12:28687055-28687077 ACTAAAATACAGACTGAGTAAGG - Intergenic
1095838031 12:46659923-46659945 ATTAAAATTCAGACTAAATAAGG - Intergenic
1095842717 12:46711730-46711752 ACTAATATTCAGAATTTATAAGG + Intergenic
1097003579 12:55899061-55899083 ACTGAGACTCAGACAGAATATGG + Intergenic
1097531532 12:60807507-60807529 ACTAATATTCAGAATCTATAAGG - Intergenic
1097600258 12:61682869-61682891 ACTAATATTCAGACTCTAGAAGG - Intergenic
1097638279 12:62147826-62147848 ACTAATATCCAGAATTAATAAGG + Intronic
1097720307 12:63012605-63012627 ACTGAGATTCAGATTAAATGAGG - Intergenic
1097736359 12:63185922-63185944 ACTGAAATTCAGCCTGATTAAGG - Intergenic
1100015272 12:90002689-90002711 TCTGTTATTCAGACTGACTGTGG + Intergenic
1100630449 12:96384021-96384043 ACTAATATTCAGAATCCATACGG + Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105961462 13:25345120-25345142 AGTAATATTCAGACTAAACATGG - Intronic
1106516484 13:30459258-30459280 ACTAATCTTCAGATTGAAGAGGG + Exonic
1107201419 13:37723289-37723311 ATTGATATTCATACTCTATAAGG + Intronic
1107223528 13:38017562-38017584 ACTAATATTCAGAATAAAAAGGG - Intergenic
1107981716 13:45740359-45740381 ACAGTTGTTCAGACTGAACAAGG - Intergenic
1110091450 13:71453915-71453937 ACTGATATTTAGACAGTATATGG + Intronic
1110461793 13:75753287-75753309 ACTGATATCCAGAATTTATAAGG - Intronic
1113224497 13:108144514-108144536 AGTTAAATTCAGACTGAATCTGG + Intergenic
1113283837 13:108823340-108823362 GCTGAGAGTCAGACTTAATATGG - Intronic
1115202261 14:30867600-30867622 ACTGATGTCCAGATTGATTAAGG - Intergenic
1116158879 14:41240939-41240961 TCTGATATGGAGGCTGAATAGGG - Intergenic
1116668654 14:47812526-47812548 ACTAATATCCAGAATCAATAAGG - Intergenic
1117221946 14:53615306-53615328 ACACACATTCAGAATGAATAAGG + Intergenic
1117498090 14:56325923-56325945 ACTGATATTCAAGCTGAAGGAGG - Intergenic
1118098707 14:62570054-62570076 ACTGGAAATGAGACTGAATAAGG + Intergenic
1120407709 14:84109621-84109643 ACTGTTATGCAGAATGCATAAGG - Intergenic
1121230912 14:92357497-92357519 AATGTTATTCAGCCTGAAAAAGG + Intronic
1123702198 15:22923226-22923248 ACTGATATTTAGAATGTATAAGG + Intronic
1123883825 15:24702776-24702798 TCTAATATTCAGAATGTATAAGG - Intergenic
1124478011 15:30052496-30052518 ACTAATATTCAGAATGTACAAGG - Intergenic
1124880356 15:33636468-33636490 AATGATCTTCACACTGAATGGGG + Exonic
1125202191 15:37110095-37110117 ACTCACATTCAGACTGATTAAGG - Intergenic
1125247854 15:37661961-37661983 ACTAATATTCAGAATCTATAAGG - Intergenic
1127727878 15:61768172-61768194 ACTTCTATCCAGACTGGATATGG - Intergenic
1127778371 15:62288047-62288069 ACGGATTTTAAGACTGAAAATGG + Intergenic
1128298982 15:66552159-66552181 ACTCACTTTCAGACTCAATACGG - Exonic
1128848984 15:70932025-70932047 ACTGATATGCTGACTAATTAGGG - Intronic
1129620663 15:77142100-77142122 ACTTATATTCAGAATATATAAGG + Intronic
1130397960 15:83521097-83521119 ACTGCTTTTCAGACTGGAAAGGG - Intronic
1132487950 16:206225-206247 ACTTATTTTCAGACTGGAAATGG - Intronic
1134481561 16:14623941-14623963 ACAGATCTTCAGCCTGAAAAAGG + Intronic
1135997715 16:27264889-27264911 ATTCATATTCAGACTATATAAGG + Intronic
1136626097 16:31463004-31463026 AGTCTTATTCAGACAGAATAGGG - Intronic
1136998872 16:35211152-35211174 ACTGAACTGCAGACTGATTAAGG + Intergenic
1137482061 16:48860359-48860381 ACTAATATTCAGAATTTATAAGG + Intergenic
1137971621 16:52991177-52991199 ACTAACATTCATACTGAAAAAGG - Intergenic
1141487162 16:84348011-84348033 ACAGAAATTCCAACTGAATAAGG + Intergenic
1142650692 17:1349568-1349590 ACTGATTTACAGACTCAATAAGG + Intronic
1143750797 17:9026027-9026049 ATTGTTATTAAGACTGATTATGG - Intronic
1144129297 17:12230270-12230292 TCTGAAATTCAGACTGAACTGGG + Intergenic
1145851079 17:28097542-28097564 TCAGATATTCAAACTGAGTAAGG - Intronic
1147898412 17:43767557-43767579 ACTGAGGTTCAGAATGATTAAGG - Exonic
1149716730 17:58798149-58798171 ACTGATATTCAGAATGTGTTAGG - Intronic
1149882747 17:60309248-60309270 ATTAATAATCAGACTGTATAAGG + Intronic
1150051363 17:61967431-61967453 ACTAACATTCAGATTGTATAAGG + Intronic
1155776998 18:29777266-29777288 ACTGATATCCAGAATCTATAAGG - Intergenic
1156869932 18:41933867-41933889 ACTGGTAATGAGACTGAATGAGG - Intergenic
1159280656 18:66280497-66280519 ACTGATACATAAACTGAATATGG - Intergenic
1159334938 18:67049926-67049948 ATTTATATGCAGACTGAAGAGGG - Intergenic
1161665355 19:5572771-5572793 CCTGGAATTCAGCCTGAATAGGG - Intergenic
1161760656 19:6168751-6168773 ACTAATATTCAGAATCTATAAGG - Intronic
1164996835 19:32726782-32726804 ACTATTATTCAGTCTGAACAAGG - Intronic
1166016863 19:39987850-39987872 ACTGATATCCAGAATAAAAAAGG + Intronic
1166576506 19:43844478-43844500 CCTAATATTCCAACTGAATATGG - Intronic
925112789 2:1350839-1350861 AATGATATTTTGAGTGAATAGGG + Intronic
926214966 2:10900515-10900537 ACTCAAAGTCAGACTGATTAGGG - Intergenic
926930184 2:18029890-18029912 ACTAATATTCAGACTATACAAGG - Intronic
927355732 2:22170946-22170968 ACTAATATTCAGAATCTATAAGG + Intergenic
928882313 2:36111083-36111105 ACTGATATCCAGAATGTACAGGG - Intergenic
931919491 2:66997749-66997771 ACTGATATCCAGAATCTATAAGG - Intergenic
933326654 2:80846494-80846516 ACTGATATTCAGAAAGAATAAGG - Intergenic
935376309 2:102401123-102401145 ACTTATAACCAGACTTAATATGG + Intergenic
938147030 2:128843475-128843497 ACTGATATCCAGAATTTATAAGG - Intergenic
939317531 2:140570733-140570755 ACTGATATTCATCATGGATATGG - Intronic
939708329 2:145482863-145482885 ACTGATATTAAAAATGAAAAGGG - Intergenic
939891383 2:147740964-147740986 ACTACTATTCAGCCTGAAAATGG - Intergenic
940076737 2:149750228-149750250 GCTAATATACAGAGTGAATATGG + Intergenic
940142157 2:150503985-150504007 ACTGATATTAAGACTCAGAAAGG + Intronic
940257951 2:151751220-151751242 AAGGATATTCAGACTAAAGAAGG - Intergenic
940536425 2:154951008-154951030 ACTGATAATCAAACTTCATATGG + Intergenic
943638223 2:190329790-190329812 ACTGATACTCATACTGAATGAGG + Intronic
945688777 2:213007000-213007022 ACTGATATTCAGAATTATGATGG - Exonic
945707887 2:213258369-213258391 CCTGATATTCAAACAGAACAGGG + Intergenic
945722433 2:213434581-213434603 ACTGATATCCAGAATTTATAGGG + Intronic
947371031 2:229445849-229445871 TCTGACATTCAGAGGGAATAGGG - Intronic
948692801 2:239717497-239717519 ACTGAGGTTCAGACAGCATAGGG - Intergenic
1170036104 20:11991841-11991863 TCTGAAATTCAAATTGAATAAGG - Intergenic
1173892596 20:46524659-46524681 ACTGAAATGCAGACCAAATAGGG - Intergenic
1175297556 20:57919482-57919504 ACTGCTGTTCACACTGAACAGGG - Intergenic
1176285633 21:5017845-5017867 ACTGAGACTCAGACTGCAGAGGG - Intergenic
1176668971 21:9714262-9714284 ACTGTTATTTTGACTAAATAAGG - Intergenic
1177538740 21:22463955-22463977 ACTCATATCCAGAATGTATAAGG - Intergenic
1179810598 21:43866718-43866740 ATTGACATTCAGACAGAACAGGG + Intronic
1179871548 21:44245630-44245652 ACTGAGACTCAGACTGCAGAGGG + Intergenic
1181895802 22:26106369-26106391 TCTGATCCTCAGACTGAATCCGG + Intergenic
1183526517 22:38326276-38326298 GCTGAAATTCAGACTGACCAGGG - Intronic
1183765409 22:39868735-39868757 TCTGATATTCAGAATCTATAAGG + Intronic
1184253496 22:43274256-43274278 CCTGAAATTCAGATTGAATGAGG - Intronic
950917543 3:16661336-16661358 ACTAATATCCAGACTCTATAAGG + Intronic
952265529 3:31782553-31782575 ACTAATATGCAGAATGCATAAGG + Intronic
955086402 3:55706935-55706957 ATTGAGACTCAGACTGAATCAGG + Intronic
955197489 3:56818633-56818655 ATTGATCTTGAGACTGAAAATGG - Intronic
955682930 3:61520865-61520887 ACTGAAATGCATGCTGAATATGG - Intergenic
956317475 3:67954423-67954445 ACTGAAATTAAAACTGAATGTGG + Intergenic
957208035 3:77223347-77223369 ACGGATATTGAAACTAAATATGG + Intronic
957338377 3:78860955-78860977 ACTCATATTGAGACTAAGTAAGG - Intronic
957389535 3:79546017-79546039 CATGATATTCATACTGAAGAGGG - Intronic
958607968 3:96384585-96384607 ACTGATATCCAGAATTTATAAGG - Intergenic
958887473 3:99743092-99743114 CCTGATATCCAGTCTGAATCTGG + Intronic
960500359 3:118430462-118430484 TCTGATATCCAGAATGTATAAGG - Intergenic
960500440 3:118431246-118431268 TCTGATATCCAGAATGTATAAGG - Intergenic
961802268 3:129460565-129460587 AATAATATTCAGACTTAAAAAGG - Intronic
962995054 3:140618663-140618685 ACTAATATCCAGAATCAATAAGG + Intergenic
963399675 3:144782022-144782044 ACATATATTCAGACTGTTTAAGG + Intergenic
965075512 3:163969913-163969935 ACTGATATTCAGAATATACAAGG + Intergenic
965102332 3:164314071-164314093 ACTGATATCCAGTTTTAATATGG - Intergenic
966093174 3:176164970-176164992 ACTGATATACAGAATCTATAAGG + Intergenic
966276301 3:178174514-178174536 ACTCATATTCAGCATGAATAAGG - Intergenic
966323227 3:178724382-178724404 ACTGATATCCAGATTCTATAAGG - Intronic
966437105 3:179900146-179900168 ACTCATTTACAGACTAAATATGG + Intronic
966476899 3:180359338-180359360 CCAGATTTTCAGACTGCATAGGG - Intergenic
967411621 3:189171982-189172004 AGTGAGATTCAGACTGAGTGGGG + Exonic
967425484 3:189322467-189322489 ACTTCTATTCAGACTGTAAAAGG + Exonic
969164240 4:5292519-5292541 ACTAATATTCAGAATCTATAAGG - Intronic
969189997 4:5510423-5510445 CCTGATATTCAGAGTTCATAGGG + Intergenic
970012507 4:11474917-11474939 AATGAGATTCAGCCTGATTAGGG + Intergenic
970169043 4:13270702-13270724 ACTAATATTTAGACTCTATAAGG - Intergenic
970385981 4:15557023-15557045 ACAAATATACAGACTGAAAAAGG - Intronic
972018377 4:34275604-34275626 ACTGATATTCAGAATCTATAAGG - Intergenic
973054931 4:45644289-45644311 ACCCATATTCATAATGAATATGG - Intergenic
973297061 4:48536064-48536086 ACAGATCTTCAGACTGAAGAAGG - Intronic
974854780 4:67447540-67447562 TCTAATATTCAGACTCTATAAGG + Intergenic
974964347 4:68742137-68742159 AATGATATTCATTCTGACTAGGG - Intergenic
975387744 4:73778005-73778027 ACTGGTATTCTATCTGAATAAGG + Intergenic
977323985 4:95551718-95551740 ACTGAAATTCAGCCTAAAGATGG + Intergenic
978917112 4:114140681-114140703 ACTGATATCCAGAATGTACAAGG - Intergenic
980032975 4:127851792-127851814 ACTAATATTCAGAATGTGTAAGG + Intergenic
980124269 4:128758634-128758656 ACTGAGTTTCAGAGTGACTAAGG - Intergenic
981968054 4:150630478-150630500 ACTGATATTCAGACTGAATAAGG - Intronic
982233467 4:153230482-153230504 ACTGGTTTTGAGACTGAACATGG - Intronic
982636332 4:157901419-157901441 ACTGATATCCAGAATCTATAAGG - Intergenic
982950990 4:161695838-161695860 ACTAATATTCAGAATCTATAAGG - Intronic
983433781 4:167685020-167685042 ACTTATATTGAGACTGAAAGTGG + Intergenic
985405811 4:189637253-189637275 ACTGTTATTTTGACTAAATAAGG + Intergenic
987945891 5:24608158-24608180 ACTGGTAATGAGACAGAATATGG + Intronic
988072850 5:26316580-26316602 ACTGATATCCAGAATCTATAAGG - Intergenic
988325721 5:29764591-29764613 ACTGATATCCAGAATCTATAAGG - Intergenic
989323241 5:40161056-40161078 TCAGATATTAAGACTGAATGAGG + Intergenic
989480883 5:41928677-41928699 ACTGAAATTCAGACTGTAAGTGG + Intronic
991415765 5:66391316-66391338 ACTAATATTCAGAATCTATAAGG + Intergenic
991572573 5:68070841-68070863 ACTAAAATTCTGACTCAATATGG + Intergenic
992133868 5:73722732-73722754 TCTGAAATTCTGAATGAATAAGG - Intronic
993642264 5:90419487-90419509 ACTGATATTCTGAATATATAAGG + Intergenic
994065694 5:95539210-95539232 ACTAATATCCAGAATCAATAAGG + Intronic
994910028 5:105892261-105892283 AATGATATTAACACTAAATAAGG + Intergenic
995394063 5:111668810-111668832 AAAGATATTCAGAATGTATAGGG - Intronic
995893210 5:116980903-116980925 AGTGATATAGAGAATGAATAGGG + Intergenic
996694582 5:126379786-126379808 ACTGATATCCAGAATGTACAAGG - Intronic
996698656 5:126426201-126426223 AGTGATATGCAGAAGGAATAAGG + Intronic
996874680 5:128227618-128227640 TATAATATTCAGAGTGAATATGG - Intergenic
997344700 5:133179704-133179726 ACTGCTATTCAGCCATAATAAGG - Intergenic
997619723 5:135278795-135278817 ACTAATATGCATATTGAATAAGG - Intronic
999593438 5:153174436-153174458 ACTAATATTCAAAATGTATAAGG - Intergenic
999923522 5:156349363-156349385 ACTAATATTCAGAATCGATAAGG + Intronic
1000263030 5:159607808-159607830 ACTAATATCCAGAATGTATAAGG + Intergenic
1000432863 5:161171021-161171043 ACTAATATTCAGAATAAACAAGG - Intergenic
1000679622 5:164167209-164167231 TCTAATATTCAGAGTGAAGATGG - Intergenic
1000709711 5:164557063-164557085 ACTAATATTCAGAATCTATAAGG - Intergenic
1002627917 5:180544994-180545016 GCTGATATTCAATATGAATAAGG - Intronic
1003237364 6:4307939-4307961 ACTGATTTTCAGATTGATTTGGG - Intergenic
1008762551 6:54870340-54870362 ATTGATATTCTGATTGAACACGG + Exonic
1009907116 6:69883798-69883820 GCTAATACTCAGACTGAAAATGG - Intronic
1010904200 6:81466219-81466241 TCTGATATTCAAATTTAATATGG + Intergenic
1011116780 6:83901903-83901925 ACTGATATCCAGAATATATAAGG - Intronic
1011580534 6:88859145-88859167 ACAGATTTTCAGACTGAGTACGG - Intronic
1014022942 6:116611529-116611551 ACTGAATTACAGAGTGAATACGG + Intergenic
1014902331 6:126983135-126983157 ACTAATATTCAGAATCTATAAGG + Intergenic
1015035143 6:128644577-128644599 ACAGATATTCAGGGTTAATAAGG + Intergenic
1020775491 7:12449507-12449529 ACTGATATTCAGAATATACAAGG + Intergenic
1021576664 7:22111618-22111640 ACTGAATTTCAGACCAAATAGGG - Intergenic
1023232144 7:38044943-38044965 ACTGATATTCAGAATACATAAGG - Intergenic
1025101333 7:56137631-56137653 ACTGATATTCAGATTCTATGTGG + Intergenic
1025857913 7:65299961-65299983 ACTGATATTTAGACTATATATGG - Intergenic
1027349510 7:77296488-77296510 ATTCATATTCAGAATAAATAAGG - Intronic
1028026115 7:85842977-85842999 ACTGATATGCAGAATTTATAAGG - Intergenic
1028037326 7:86001389-86001411 ATTAATATTCAGAATGCATAAGG + Intergenic
1028933326 7:96438735-96438757 CCTAATATTCAGACTCTATAAGG + Intergenic
1031536338 7:122937960-122937982 ACTAATATCCAGACTCAACAAGG - Intergenic
1041510522 8:58650130-58650152 ACTAATCTTCAGACTGAAAGAGG - Intronic
1042527544 8:69779918-69779940 ACTGATATCCAGAATTTATAAGG + Intronic
1042943742 8:74133903-74133925 ACTGATATCCAGAATCTATAAGG + Intergenic
1043397058 8:79848501-79848523 ACTTATATTCAGACTCTACAAGG + Intergenic
1043871041 8:85433180-85433202 ACTAATATCCAGAATGTATAAGG - Intronic
1044199880 8:89421734-89421756 ACTGAACATCAGACAGAATATGG - Intergenic
1044894100 8:96870360-96870382 ATTGATATACAGATTAAATACGG + Intronic
1046119907 8:109832802-109832824 TCTAATATTCAGAATGTATAGGG + Intergenic
1047081379 8:121465031-121465053 TCTAATATTCAGAATCAATAAGG - Intergenic
1047383810 8:124389603-124389625 ACTAATATTCAGACTCTACAAGG - Intergenic
1050298310 9:4229897-4229919 ACTGATATTTACACTGAAGGTGG + Intronic
1056555913 9:87686861-87686883 ACTGATATTCAGAGTGAGCCAGG + Intronic
1057310866 9:93942304-93942326 AATGTTATTCAGACTTAAAAAGG - Intergenic
1057789873 9:98117873-98117895 ACTGTTATTCAGAATTAACAAGG - Intronic
1058069609 9:100588487-100588509 ACTGATATTTATTCTGCATAGGG - Intergenic
1060946550 9:127572752-127572774 AATGATATTCAGGCTGAGCACGG + Intronic
1062553786 9:137104606-137104628 GCAGATATTCAGCCTGAAAAAGG - Intronic
1203656895 Un_KI270753v1:6673-6695 ACTGTTATTTTGACTAAATAAGG + Intergenic
1186627342 X:11308692-11308714 ACTGAAGTTCAGAGTGAATCAGG - Intronic
1187108812 X:16274135-16274157 ACTAATATTCAGAATCTATAAGG - Intergenic
1187957874 X:24537983-24538005 ACTTACATACAGACTGAAAATGG - Intronic
1188363826 X:29289678-29289700 ACAGATAGTGAGACTCAATATGG - Intronic
1188398339 X:29714120-29714142 ACTGATTTTTTGACTTAATATGG + Intronic
1188610080 X:32084616-32084638 ACTGATATTCATATTCAATTTGG - Intronic
1189874593 X:45422524-45422546 TCTGATATCCAGAATGTATAAGG + Intergenic
1193095886 X:77548693-77548715 ACTGGTATTAAGAATGACTAAGG + Intronic
1193321398 X:80126132-80126154 ACTAATATTCAGAATCTATAAGG - Intergenic
1193354890 X:80507748-80507770 ACTAATATCCAGACTCTATAAGG + Intergenic
1193506823 X:82354644-82354666 ACTAATATTCAGAATATATAAGG + Intergenic
1193517706 X:82490063-82490085 ACTAATATCCAGACTCTATAAGG + Intergenic
1193580264 X:83255940-83255962 ACTAATATTCAGAATTTATAAGG + Intergenic
1193747379 X:85298526-85298548 ACAGATACTAAGGCTGAATAGGG - Intronic
1193938229 X:87649364-87649386 AATGATATTCAGCCTTAAAAAGG - Intronic
1193976262 X:88123041-88123063 TCTGATATTCAAACTCTATAAGG + Intergenic
1194030869 X:88812318-88812340 TCTAATATCCAGAATGAATAAGG - Intergenic
1194099717 X:89688842-89688864 TCTGATATTCAGAATCTATAAGG - Intergenic
1194927989 X:99850185-99850207 ACTGATTTTCACACTGCACAAGG - Intergenic
1195919712 X:109971529-109971551 ACTTCTATTCAGACTGATCAGGG - Intergenic
1196261890 X:113592875-113592897 ACTGATTTTAAGACTGGAGAAGG - Intergenic
1197086600 X:122483807-122483829 ACTGATATCCAGAATTTATAAGG + Intergenic
1198000283 X:132427325-132427347 ACTGAAGTTAAGACTGAATTTGG + Intronic
1199790079 X:151145364-151145386 ACTAATATCCAGAGTCAATAAGG + Intergenic
1199821116 X:151447852-151447874 ACTGATATCCAGAATTTATAAGG + Intergenic
1200369570 X:155709542-155709564 ATTGATAATCAGAATAAATAAGG - Intergenic
1200452722 Y:3350225-3350247 TCTGATATTCAGAATCTATAAGG - Intergenic
1200881721 Y:8220171-8220193 ACTGAGACTGAGAGTGAATATGG + Intergenic