ID: 981976312

View in Genome Browser
Species Human (GRCh38)
Location 4:150733353-150733375
Sequence CTGAAGTATTTTGAGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 8, 3: 45, 4: 343}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981976308_981976312 14 Left 981976308 4:150733316-150733338 CCAGATTAAGACAGAGAATGTGC 0: 1
1: 0
2: 0
3: 18
4: 170
Right 981976312 4:150733353-150733375 CTGAAGTATTTTGAGGTAGAAGG 0: 1
1: 0
2: 8
3: 45
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981976312 Original CRISPR CTGAAGTATTTTGAGGTAGA AGG Intronic
901584312 1:10275028-10275050 CTGAAGTGTTTAGGGGTAAATGG + Intronic
902626777 1:17681249-17681271 CCGAAGTATTTAGGGGTAAAGGG - Intronic
903597480 1:24506505-24506527 CTGAAGTATTTGGAAGTAAAAGG + Intronic
904376349 1:30084812-30084834 CTGAAGTCTTATGAGGTGGGTGG + Intergenic
904844379 1:33397844-33397866 CTGAAGCATTTTGAGTTCAAAGG - Intronic
904943288 1:34179792-34179814 CTGAAGCACCTTGAGGTATATGG - Intronic
905510919 1:38519270-38519292 CTGAAGTCTTTAGGGGTAAAGGG + Intergenic
909427531 1:75544575-75544597 CTGAAGTATTTAGAGATAAAGGG - Intronic
910968233 1:92829276-92829298 CTGAACTATTTTGGAGTAGTGGG - Intergenic
911419085 1:97616629-97616651 CTTAAGTAATTTGAGCTACATGG - Intronic
911922279 1:103780419-103780441 CTGATGAATGTTGAGGAAGAAGG + Intergenic
913986240 1:143568792-143568814 CTGAAGGATTTGCAGGTATATGG + Intergenic
914398010 1:147289359-147289381 GTGCGGTATTTTGAGGTACAAGG + Intronic
915259658 1:154667675-154667697 CTAAAGTATTTGGGGGTAAAGGG - Intergenic
915647403 1:157283296-157283318 ATGAAGTATTGAGAGGGAGATGG + Intergenic
916707587 1:167367966-167367988 CTGAAGTATTTAGAAGTAAATGG - Intronic
916893798 1:169140065-169140087 CTGAAGTATTGAGAGATAAAGGG + Intronic
918668951 1:187188799-187188821 CTGAAGTCTTTTCAGATAGCAGG + Intergenic
919079522 1:192853177-192853199 CTGAAGTATTTAGAAGTAAAAGG - Intergenic
919964217 1:202505110-202505132 CTGAAGAATTTTGAGGAATAAGG + Intronic
922273314 1:224054362-224054384 CTAAAGTATTTTGACATAGAAGG + Intergenic
923043042 1:230333397-230333419 CAGAAGTTTCTTGAAGTAGATGG - Intronic
1064139497 10:12778512-12778534 CTGCAGTAGATTGTGGTAGATGG + Intronic
1064333921 10:14421128-14421150 CTGAAGTATTTAGTGGTAAAGGG + Intronic
1064809352 10:19177441-19177463 ATGTAGTATTTGGAGGTATAGGG + Intronic
1067938989 10:50636507-50636529 GTGAAGTATTGTGGGGTGGAAGG - Intergenic
1068001232 10:51336550-51336572 AAGAAGGATTTTGAGGTTGAGGG - Intronic
1068052636 10:51970112-51970134 TTGTAGTATTTTGAGGTCAAGGG - Intronic
1068562298 10:58528610-58528632 TTGAGTTATTTTGAGTTAGAGGG + Intronic
1069189870 10:65473679-65473701 CTGGAATATTTGGAGGAAGAAGG - Intergenic
1070239569 10:74665028-74665050 CTGAAGTATTAAGGGGTAAAAGG + Intronic
1071482903 10:86078540-86078562 ATGAAGTCTTTTGAGAAAGAAGG - Intronic
1071596577 10:86932224-86932246 CTGAAGTATTTAGGGATAAAGGG - Exonic
1071953314 10:90729264-90729286 CAGAAGTATTTTTAGTTAGCTGG - Intergenic
1072002197 10:91207487-91207509 CTGAAGTATTTAGAGGTAAAGGG - Intronic
1073550222 10:104393153-104393175 ATAAAGTACTTTGAGGTCGATGG + Intronic
1073567229 10:104545477-104545499 ATGAAGTGTTATGAGGCAGAGGG + Intergenic
1074610968 10:115021225-115021247 AGGAAGTATTCAGAGGTAGAAGG + Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1075845524 10:125542305-125542327 GTGAAGTATTTAGAGTTTGAGGG - Intergenic
1075969842 10:126643107-126643129 ATGAAGTATTTTGAAGTTGCTGG - Intronic
1075977883 10:126712497-126712519 CTGAAGAATTTAGGGGTAAAAGG + Intergenic
1078744816 11:14102035-14102057 CTGAAGTATTTAGAGGTAAAAGG - Intronic
1079481239 11:20882607-20882629 CTGAAGTATTTAGGGGTAGAGGG - Intronic
1079955224 11:26853859-26853881 CTGAAATATTTAGAAGTAAAGGG + Intergenic
1080029109 11:27642425-27642447 ATGAAGTATTTAGAGCTGGAGGG + Intergenic
1082999191 11:59276124-59276146 CTGAAGAATTTTTAGTTCGATGG - Intergenic
1083162646 11:60864662-60864684 CTGAAGCAATTAGAGGTAAAGGG + Intergenic
1083663062 11:64260933-64260955 CTGAAGTATTTATGGGTAAAGGG + Intronic
1083719467 11:64597301-64597323 CTGCAGTATTTGGAGGGAGCTGG - Intronic
1084913925 11:72413432-72413454 ATGAAGTATTTGGAGGTAAAGGG - Intronic
1085120202 11:73962679-73962701 CTGAAGTATAGTCAGGGAGAAGG - Intronic
1085846571 11:80072813-80072835 CAAAAGTACCTTGAGGTAGATGG - Intergenic
1085945390 11:81264996-81265018 CTGAAGTATTTAGAAATAAAGGG - Intergenic
1087933483 11:104004607-104004629 CTGCAGTATTTTGAACTACAGGG + Intronic
1088303863 11:108387485-108387507 CTGAAGTTTTTTGCAGTAGGAGG + Intronic
1088458438 11:110057753-110057775 CTGAAATATTTAGAAGTAAAGGG + Intergenic
1089280634 11:117371909-117371931 CTGAACTATGATGAGGTAGGAGG - Intronic
1090399812 11:126441858-126441880 CTGAAGGATTTTTAGGAAGGAGG - Intronic
1090624264 11:128592163-128592185 GAGAAGTATTTTGAGGGAGAAGG - Intergenic
1091571272 12:1688790-1688812 CTGAAGTATGGTCAGGGAGAGGG + Intronic
1093204287 12:16228495-16228517 ATGATGTATTTGGAGGTAGGGGG - Intronic
1093512161 12:19942256-19942278 CTGAAGTATTTTGTGGAGGCAGG + Intergenic
1094555611 12:31496839-31496861 ATGAAATATTTTAAGGTAGACGG + Intronic
1094696644 12:32825941-32825963 AAGCAGTATTTTGAGGCAGAAGG - Intronic
1096431223 12:51544872-51544894 CTGAAGTATTTAGGAGTAAAGGG - Intergenic
1097201047 12:57279059-57279081 CTGAAGTATTCTCTGGTAGCTGG - Intronic
1097313710 12:58149932-58149954 CTGCATTATTTTGAAGTATACGG + Intergenic
1097775658 12:63641269-63641291 TTAAAGTATTTTGAGGGAAAAGG - Intronic
1099943289 12:89216056-89216078 CTGAAGTAATTTTATGTAGGAGG - Intergenic
1100112796 12:91265800-91265822 TTGAAGAATTTTGAAGAAGAGGG + Intergenic
1101577331 12:106010023-106010045 CTGAAGTATTAAGAGGTGAAGGG + Intergenic
1102196745 12:111031317-111031339 CTGAAGTATTTAGGGATAAAGGG - Intergenic
1102676634 12:114664019-114664041 CTGACGTATGTGGAGGTGGAAGG + Intergenic
1104425690 12:128675944-128675966 CTGAAGTAGTTAGAGTTAAAAGG - Intronic
1105208592 13:18243584-18243606 CTGAAATAATGTGGGGTAGAGGG + Intergenic
1107027028 13:35812355-35812377 ATCAAGTATTTTGATGTACATGG - Intronic
1107205782 13:37785830-37785852 CTGGAGAACTTTGAGGAAGAGGG + Intronic
1107557072 13:41525889-41525911 CTGAAGTGTTTAGAAGTAAAGGG - Intergenic
1108460076 13:50656933-50656955 AGGACGTATTTTGAGGGAGAAGG + Intronic
1109536625 13:63730424-63730446 CTGAAGTTTTGAGATGTAGATGG + Intergenic
1109874124 13:68376327-68376349 GTGAAATATATTGAGGTAAAGGG - Intergenic
1110209232 13:72953071-72953093 CTGAGGTCTTTTCAGGGAGAAGG + Intronic
1111339652 13:86866955-86866977 CTGAAGTATTTAGGGGTAAAGGG - Intergenic
1112028213 13:95432195-95432217 TTGAAGTTTTTTGAAGTAAAGGG + Intergenic
1112284543 13:98092858-98092880 CTGAGGTATTTTCAGTTAGAGGG + Intergenic
1112665832 13:101572259-101572281 CTGAAGTAGTTTGGAGCAGAAGG + Intronic
1112938782 13:104834378-104834400 CTAAAGTATATAGAGATAGAGGG - Intergenic
1114698093 14:24646177-24646199 CTGAGGTCTTTTCAGGTGGAAGG - Intergenic
1115544343 14:34451951-34451973 CTGCAGTTTTTTGAGGTCAAAGG - Intronic
1116999070 14:51353912-51353934 CTGAGCTGTTTTGAGGCAGAGGG + Intergenic
1119358610 14:74028405-74028427 CTGAAGTCTTCTGGGGTAAAAGG + Intronic
1119579493 14:75764294-75764316 ATAAAGTATTTTAAGGTATAAGG + Intronic
1119905141 14:78295015-78295037 TAGGAGTGTTTTGAGGTAGAAGG + Intronic
1120666984 14:87317756-87317778 CTGAAGTATTTTAAAGTAAATGG - Intergenic
1121545565 14:94760825-94760847 CTACAGTCTTATGAGGTAGAGGG - Intergenic
1123832220 15:24152014-24152036 CTGAAATATTTTGAAGAACAAGG + Intergenic
1123838126 15:24217262-24217284 CTGAAATATTTTGAAGAACAAGG - Intergenic
1123847677 15:24319561-24319583 CTGAAATATTTTGAAGAACAAGG - Intergenic
1123866720 15:24526942-24526964 CTGAAATATTTTGAAGAACAAGG - Intergenic
1124563277 15:30794352-30794374 CTGAAGGATCTGGAGGTAGGAGG + Intergenic
1124960009 15:34386881-34386903 CTGAAGGATCTGGAGGTAGGAGG - Intronic
1124976638 15:34533102-34533124 CTGAAGGATCTGGAGGTAGGAGG - Intronic
1125370377 15:38969687-38969709 CTGAAGGATTGTGAGCTGGAAGG - Intergenic
1125625031 15:41101396-41101418 CTTCAGCATTTTGAGGAAGAGGG - Intronic
1126249823 15:46554438-46554460 CTGAAGTATGTAGGGGTAGCAGG - Intergenic
1127206847 15:56730552-56730574 CTGAAGTAGTTTGATGTTGGAGG - Intronic
1128254088 15:66184584-66184606 TTGAAGGATTTTAAGGTAGGGGG - Intronic
1128584579 15:68837031-68837053 TTGAAGTATTTTTTGGTGGAGGG - Intronic
1129124597 15:73427883-73427905 CTGAGGAATTTTGAGCTAGAGGG - Intergenic
1130042460 15:80416360-80416382 TTGAAGCATTTAGAGTTAGAAGG - Intronic
1130226335 15:82061077-82061099 CTGAAGAATTTAGGGGTAAAGGG - Intergenic
1131037422 15:89232430-89232452 CTGAAGTATTTAGGAGTAGAAGG - Intergenic
1132126099 15:99226331-99226353 CTGAAGAATTTGGGGGTAAAGGG + Intronic
1133482138 16:6181217-6181239 CTCATGTGTTTTCAGGTAGAAGG - Intronic
1134770075 16:16800528-16800550 CTCAAATTTTTTGAGGGAGAAGG + Intergenic
1137385478 16:48038695-48038717 CAGAAGTATTTTTAGGTTGAAGG - Intergenic
1138322676 16:56130314-56130336 CTAAAGTATTCTGTGGTAGCAGG + Intergenic
1138359342 16:56413996-56414018 CTGAAGTATTTAGGGGTAAAGGG + Intronic
1139313191 16:66044310-66044332 GTGAAGTATGGTGGGGTAGATGG + Intergenic
1143088087 17:4431874-4431896 CTGAAGTATCTAGAGGTACAGGG - Intergenic
1144162728 17:12577759-12577781 CTGAAGGGTTTTGAGCAAGAAGG - Intergenic
1146405745 17:32535867-32535889 CTGTAGTAACTTGAGGGAGAAGG + Intronic
1146551511 17:33784072-33784094 CTGAAGTTTTGTGAGGTTGGGGG + Intronic
1146746588 17:35336253-35336275 CTGAAGTATTTAGAGGTAAATGG + Intergenic
1146756533 17:35437017-35437039 CTGAAGTATTTAGTGGTAAATGG + Exonic
1147277576 17:39331896-39331918 CTGAGGTATTTTGTTGTAGCAGG - Intronic
1148119381 17:45198853-45198875 CTGAAGTATTTGGGGGCAAAGGG - Intergenic
1149106148 17:52968531-52968553 CTGAAGTATTTTGATATAAAGGG - Intergenic
1149665485 17:58362414-58362436 CTGGGGTATTTTGATGTAAATGG + Intronic
1151766154 17:76134378-76134400 CTGAAGTATTTAGTGGTATGGGG + Intergenic
1153205989 18:2701621-2701643 GTGAAGTACTTTGAGCTAAAAGG + Intronic
1153463087 18:5358857-5358879 CTGAAGTATTTCTAGGAACAGGG + Intergenic
1153599489 18:6765456-6765478 CTGTAGGATTTTTAGGTACACGG + Intronic
1155128787 18:22908686-22908708 GGAAAGTATTTTGAGCTAGATGG - Intronic
1155310639 18:24519418-24519440 CTCAAGTATTCTGGGGTAAAGGG - Intergenic
1155382080 18:25234339-25234361 CTCTACTATTTTGAGTTAGAAGG + Intronic
1155468284 18:26163637-26163659 ATGAAGTATTCAGAGGTAGGGGG + Intronic
1155965345 18:32030390-32030412 CTGAAATACTTTCAGGTAAATGG + Intronic
1156958837 18:42998264-42998286 ATGAATTATTTTGAGACAGATGG - Intronic
1158123738 18:54079575-54079597 CTAAAGTATTTAGAGGTAACAGG + Intergenic
1158473088 18:57755958-57755980 CTGAAGTATTTAGGGGTAAAGGG - Intronic
1164521795 19:28985283-28985305 TTGAAGGAGTCTGAGGTAGACGG + Intergenic
1164924245 19:32114823-32114845 ATGAAGTATTTAGGGGTAAAGGG + Intergenic
1165480730 19:36062343-36062365 GTGAAGTATTTAGAGATATAGGG - Intronic
1165852378 19:38857058-38857080 GTGCAGTATTTTGAGATAGTGGG - Intergenic
1166545038 19:43629163-43629185 GTGAAGGATTATGAGGGAGATGG - Intronic
1166624671 19:44339839-44339861 CTGAAGTATTTAGAGAAAAACGG + Intronic
1166681473 19:44770122-44770144 CTGAAGCATTTAGAGGCAAAGGG + Intergenic
926103012 2:10132632-10132654 CTGAAGTATTTTGGGGTGGATGG + Intergenic
926532096 2:14060867-14060889 GGGAAGTATTGAGAGGTAGAGGG + Intergenic
926776274 2:16426195-16426217 CTGGAGTATTTTCAGCTTGAAGG - Intergenic
927749197 2:25651441-25651463 CTGATTTCTTTGGAGGTAGAAGG + Intronic
928025314 2:27734918-27734940 CTGAAGTATTTAGGGATAAAGGG - Intergenic
928156411 2:28881011-28881033 CTGAAGTATTTAGGGATAAAGGG - Intergenic
928708511 2:33978236-33978258 CTGTATTACTTTTAGGTAGAGGG + Intergenic
928938089 2:36701411-36701433 CTGAAGTAGTTTGAGTCATAAGG - Intronic
929584170 2:43103029-43103051 CTGAAGTATTTAAGGGTAAAGGG + Intergenic
929590772 2:43144519-43144541 CTGAAGTATTTAGAGGTAAAAGG + Intergenic
930008753 2:46918282-46918304 CTGAAGGATTTAAAGGTAAAGGG - Intronic
930072177 2:47375614-47375636 CTGAAGTACTTAGGGGTAAAGGG - Intronic
930371287 2:50504356-50504378 CTGAAGTATTTCGGGTTAAAGGG + Intronic
930414215 2:51069441-51069463 CTGAAGTATTGATAGGGAGAAGG + Intergenic
930995201 2:57708618-57708640 CTGACTTTTTTTGGGGTAGAGGG + Intergenic
932397284 2:71456664-71456686 CAGAAGCTTTGTGAGGTAGAGGG + Intronic
932708385 2:74044781-74044803 CTGAAGTATTTAGGAGTAAAGGG - Intronic
934933555 2:98447729-98447751 GTGAAGTATTTAGAGGTAAAAGG - Intronic
936388389 2:112051187-112051209 CTGAAGTATTTAAAGGTAAGCGG - Intergenic
937355936 2:121198109-121198131 CTGAAATATTCAGAGGTAAAAGG + Intergenic
937832659 2:126440575-126440597 CTGAAGTATTTAGAGGAAAGGGG - Intergenic
938605306 2:132886350-132886372 CCGAAGTATTAAGAGGTAAAAGG - Intronic
941469525 2:165867192-165867214 CTGAAGTACTTAGGGGTACAGGG + Intronic
942211978 2:173680410-173680432 CTGAAGTATTTAGGTGTAAAGGG + Intergenic
942768950 2:179492100-179492122 GTGAATTAATTTGAGGGAGATGG - Intronic
943040529 2:182799261-182799283 CTGAAGTATTTAACGGTAAAGGG + Intergenic
945509637 2:210685055-210685077 CTGAAGTGTTTTAAGTTAGAAGG + Intergenic
946283287 2:218682360-218682382 CTAAAGTATTTAGGGGTAAAGGG - Intronic
946565756 2:220963628-220963650 CTAAAGTATTTAGGGGTAAAGGG - Intergenic
946960585 2:224980924-224980946 CTCAGTTATTTTGAGGTATAAGG + Intronic
947594037 2:231399788-231399810 ATGAAGAATTTGGAGGGAGAAGG + Exonic
947946621 2:234109195-234109217 CTGAAGAATTTAGAGGTAAAGGG + Intergenic
1169362538 20:4963088-4963110 TTGCAGTATTTCCAGGTAGAGGG - Intronic
1169716003 20:8619053-8619075 CTGAAGGAGTTTGAAGTAAATGG - Intronic
1170241996 20:14176784-14176806 TTGTATTATTTTGAGGTAAAGGG - Intronic
1170849220 20:19989027-19989049 TTGAAGTATTTAGGGGTAAAGGG - Intronic
1170922341 20:20690837-20690859 CAGATGTAGTTGGAGGTAGATGG - Intronic
1171824929 20:29887978-29888000 TTGAAGCATTTTGAGGTGTATGG - Intergenic
1172671742 20:36639243-36639265 CTGACGTCCTTTGAGGAAGAGGG + Intronic
1172729891 20:37077752-37077774 CTGAAGTATTTTTGGGTAAAGGG - Intronic
1172731028 20:37087905-37087927 GTGAAGTATTTTGGGGTAAAAGG + Intronic
1172911119 20:38409764-38409786 CTGAAGTATTAAGGGGTAAAGGG + Intergenic
1173094767 20:40014901-40014923 CTTAAGTAATTTCAGGAAGAGGG - Intergenic
1174326404 20:49782423-49782445 CTGAAATATTATGAGGTAAATGG - Intergenic
1174567291 20:51474542-51474564 CTGAAGTATTTAAAAGTAAAAGG + Intronic
1175847671 20:62066817-62066839 CTGAAGTATTTCTAGAGAGAAGG - Intergenic
1178160800 21:29911982-29912004 CTGAAGTATTTAGAATTAAAGGG + Intronic
1180644049 22:17323304-17323326 CTGAAGAATTTAGAGGTAAAAGG + Intergenic
1180778638 22:18506639-18506661 CTGAAATAATGTGGGGTAGAGGG + Intergenic
1180811363 22:18763947-18763969 CTGAAATAATGTGGGGTAGAGGG + Intergenic
1181197514 22:21198201-21198223 CTGAAATAATGTGGGGTAGAGGG + Intergenic
1181337362 22:22148038-22148060 CAGAAGTGTTTAGAGGTAAAGGG + Intergenic
1181396052 22:22623073-22623095 CTGAAATAATGTGGGGTAGAGGG - Intergenic
1181704233 22:24638980-24639002 CTGAAATAATGTGGGGTAGAGGG - Intergenic
1181881353 22:25982762-25982784 CTTAAGGATCTTGAGGTAGGGGG - Intronic
1182385174 22:29932923-29932945 CTCAAGTATTTAGAGGCAAAGGG - Intronic
1182747563 22:32617268-32617290 CTGAAGTATTTTCAGATGAAAGG + Intronic
1183503854 22:38197813-38197835 CTAGAGTATTTAGAGGTAAAAGG - Intronic
1203229285 22_KI270731v1_random:96634-96656 CTGAAATAATGTGGGGTAGAGGG - Intergenic
949681887 3:6523507-6523529 CTAAATTATTTTGCAGTAGATGG + Intergenic
951379440 3:21965777-21965799 CTGAAGTATTTAGGGATAAAAGG + Intronic
951481925 3:23170264-23170286 CTGAAGTAATTTGCTATAGAAGG + Intergenic
951770393 3:26249483-26249505 CTGATTTATTCTGAGGCAGATGG - Intergenic
951870200 3:27353454-27353476 CAGAAGTATTTAGAGGCAAAAGG + Intronic
952023320 3:29049094-29049116 CTGAAGTATTTTTATGCAGAAGG - Intergenic
952285765 3:31968144-31968166 CTGAAGTATTTAAGGGTAAAGGG - Intronic
952499628 3:33948568-33948590 CTGAACTGTTTTGAGGAAGATGG - Intergenic
954258865 3:49424584-49424606 CTGGAGTGTTTTTGGGTAGAAGG + Exonic
956543603 3:70373887-70373909 TTGAAGTATTTTTATGTTGATGG + Intergenic
957576452 3:82014601-82014623 CTGAATTATTTTGAGGGCCAGGG + Intergenic
961039773 3:123669589-123669611 CTGAAGTATTTAGGTGTAGAGGG + Intronic
961832210 3:129629065-129629087 CTGAAGTAATTTGAAAAAGATGG + Intergenic
962307116 3:134298651-134298673 CTGACTTATTTAGAGGTAAAGGG - Intergenic
964080631 3:152751440-152751462 CTGAAGTAATTTCAGTTACATGG - Intergenic
964465749 3:156989902-156989924 CTGAAGTATCTAGAGGTAAAGGG - Intronic
965662311 3:171054317-171054339 TTGAAGGATTTAGAGCTAGAAGG - Intergenic
965767948 3:172151523-172151545 GTGAAGTATCTAGAGGTAGATGG - Intronic
966298250 3:178449221-178449243 CTGAAGTGTTTTGGGGTATCAGG - Intronic
967286633 3:187877623-187877645 CTGAAGTATTTAGGAGTAAAAGG + Intergenic
967575940 3:191093426-191093448 CTGAAGTATTGTTAGGGTGAAGG - Intergenic
967881954 3:194307782-194307804 CTGAAGTATTGTGGGGGAAATGG + Intergenic
968237800 3:197047242-197047264 CTGAAATATTTAGAAGTAAAGGG + Intronic
970156724 4:13149579-13149601 CTCAAGATGTTTGAGGTAGATGG - Intergenic
971888026 4:32478217-32478239 CTCAAATATTTTTAGATAGATGG - Intergenic
972359287 4:38312720-38312742 CTAAATTATTTTGAAGTAAATGG - Intergenic
972480874 4:39494639-39494661 CTGAAGTATTTAGGGGAAAAGGG + Intergenic
972889672 4:43541312-43541334 CTGGAGTATTTAGAGGTGAAGGG - Intergenic
973746482 4:53968222-53968244 CTGAAGCATTCTGAGGTGGGAGG + Intronic
973796106 4:54428336-54428358 CAAAAGTATTTTGACGGAGATGG + Intergenic
974664421 4:64939342-64939364 CTGAAGTACTTGGAGTTCGATGG + Intergenic
975438310 4:74380146-74380168 CTGAGTTATTTTGAGGAAGCAGG + Intronic
976307683 4:83577454-83577476 CTGAAGTATTTGGGGGTAATGGG + Intronic
976595422 4:86891321-86891343 GTGAAGTATTTTGAGGTGTCTGG - Intronic
978136698 4:105270936-105270958 CTGAAGTAATTTGAAGAAGCTGG + Intronic
978259587 4:106738884-106738906 GTGAAGTATTTTGAGGGTGTGGG + Intergenic
978637330 4:110824915-110824937 CTGAAGTGTTTTGAAGTCTATGG + Intergenic
979408274 4:120341696-120341718 ATGAAATATTTTGGGGAAGAGGG + Intergenic
981976312 4:150733353-150733375 CTGAAGTATTTTGAGGTAGAAGG + Intronic
982054537 4:151534814-151534836 CTGAAGGCTTTTGATGTAAACGG - Intronic
982747179 4:159116473-159116495 TGGAAGTATTTTGTGGAAGACGG + Intronic
983661457 4:170134056-170134078 CTGAAGTTTTATCAGGTTGAAGG + Intergenic
984359770 4:178713628-178713650 CATAAGTATGTTGAGGTAGATGG + Intergenic
985190213 4:187364881-187364903 CTGAAGTATTTAGGAGTAAAGGG + Intergenic
985320947 4:188710664-188710686 CTGAACAATTTGGAGGCAGAAGG - Intergenic
986511859 5:8515951-8515973 ATGAAGTATTTAGAGGTAATGGG - Intergenic
987659605 5:20855235-20855257 CTGCAGCATTTTCAGGTACATGG - Intergenic
987856964 5:23432425-23432447 CTGAAGTATTTAGGGGTTAAGGG - Intergenic
988504699 5:31811656-31811678 CTGAACTATTATGGGGTCGAGGG + Intronic
988764039 5:34350412-34350434 CTGCAGCATTTTCAGGTACATGG + Intergenic
990341002 5:54822952-54822974 CTGAAATATTTAGAGATAAAGGG + Intergenic
990589285 5:57245814-57245836 CTGAAGTATTTAGAAATAAAAGG + Intronic
991032392 5:62096259-62096281 CTGGTGTATTTTTTGGTAGAAGG - Intergenic
991083844 5:62630288-62630310 CTAAAGTATTTGGAGATAAAGGG - Intergenic
991226879 5:64283967-64283989 CTTAAGTATTTTGTGGTGGCCGG + Intronic
991257646 5:64632544-64632566 CTGGAGTAGTTTGAGGAAGCAGG - Intergenic
993144051 5:84071173-84071195 ATGAAGTATTTTGTGGGAAAGGG + Intronic
994356885 5:98802751-98802773 CTGAGATATTTTGAAGTAAAAGG + Intergenic
994998085 5:107090510-107090532 CTGAAGTATTTTAAAGGAAAGGG - Intergenic
995225971 5:109701452-109701474 CTGAAGAGTTATGAGTTAGATGG + Intronic
995293702 5:110491990-110492012 CTGAAGTATTTTTAGTTAATAGG - Intronic
995542223 5:113196514-113196536 GTGAAATATTTTGATGTATAAGG + Intronic
998409661 5:141899896-141899918 CAGGAGTATTTTGCTGTAGAAGG + Intergenic
998709317 5:144804758-144804780 CTGAAATATTTAGAGATAAATGG - Intergenic
998838490 5:146228225-146228247 CAGAAATATTATCAGGTAGATGG + Intronic
999225328 5:150018082-150018104 TTGAAGTATTTAGAGCCAGAGGG + Intronic
999450999 5:151678089-151678111 CTGAGATAGTTTGAGGTTGAAGG + Intronic
1000108300 5:158082038-158082060 CTGAACTACTTTTAGGTATAGGG + Intergenic
1000387936 5:160693357-160693379 CCAAAGTATTTAGAGGTAAAGGG + Intronic
1001074273 5:168613863-168613885 CTGATGTATTTAGGGGTAAAGGG + Intergenic
1001973061 5:175972273-175972295 CTGAAATATTTAGGGGTAAAGGG - Intronic
1002017696 5:176338600-176338622 CTGAAGTATTGAGGGGTAGAGGG + Intronic
1002164351 5:177335371-177335393 CTGATGTATTTTTAGGCAGATGG - Intronic
1002244373 5:177871509-177871531 CTGAAATATTTAGGGGTAAAGGG + Intergenic
1002669492 5:180855074-180855096 CTGAAGTATTTAGGGATAAAGGG + Intronic
1003605393 6:7555452-7555474 CTGAAATATTTGGGGGTAGAAGG + Intronic
1003779694 6:9410484-9410506 CTGAAGTATTTAGGGGTAAAGGG - Intergenic
1003803461 6:9698668-9698690 CTAAAGTATATTTTGGTAGAGGG - Intronic
1003980861 6:11388517-11388539 CTGCAGTGTTTTGGGGCAGAGGG - Intergenic
1004776323 6:18849775-18849797 CTAAAGGATTTAGAGGTAAAGGG - Intergenic
1006846857 6:37068326-37068348 CAGAAGTATTTTGAACTCGATGG + Intergenic
1008735686 6:54541067-54541089 CTTAAGAATTTTGAGGGAGAAGG - Intergenic
1009253614 6:61345566-61345588 TTCAAGTGCTTTGAGGTAGATGG + Intergenic
1009258300 6:61447387-61447409 TTCAAGTGCTTTGAGGTAGATGG + Intergenic
1009283379 6:61780031-61780053 GAGAAGTATTTTGAAGTACACGG + Intronic
1009796847 6:68480154-68480176 CTAAGGTATTTTGATGTAGCAGG + Intergenic
1010431853 6:75786823-75786845 CTGAAGTGTTTAGGGGTAAAGGG - Intronic
1010709353 6:79154394-79154416 CTGAAGTATTTTCAGTGAGTTGG - Intergenic
1010713649 6:79204411-79204433 CTGAAGCATTGTGTGGCAGAGGG - Intronic
1012507579 6:99966112-99966134 CTCAAGTCCTTTGAGGAAGATGG + Intronic
1013747497 6:113363017-113363039 CTCAACTGTTTTGAGGAAGAAGG - Intergenic
1015115718 6:129647276-129647298 CTGAAGGAGTTTTAGGTAGAGGG - Intronic
1015446719 6:133314624-133314646 CTGAAATATTTTCATGCAGAAGG - Intronic
1016376451 6:143425694-143425716 CTGAAGCATTTCGGGGTAAAGGG + Intronic
1016437651 6:144053952-144053974 CTGATGGATTTTGAAGTTGATGG - Intronic
1018023067 6:159780997-159781019 CTGAAGTATTTTGTGGAGGCTGG - Exonic
1018379560 6:163245912-163245934 CTGCAGAATTTGGAGGTAGGAGG - Intronic
1020184222 7:5946652-5946674 CTGAGGGATTGTGATGTAGACGG - Intronic
1020298695 7:6778114-6778136 CTGAGGGATTGTGATGTAGACGG + Intronic
1020361152 7:7328119-7328141 CTGAAGTCTCCTGAGGAAGACGG - Intergenic
1021769649 7:23985451-23985473 CTGAGGTCTTTTCAGGGAGAAGG - Intergenic
1022324873 7:29322109-29322131 ATGAAGTAATATGAGGTAAAGGG + Intronic
1022649732 7:32263459-32263481 CTTAAGTATTTAGGGGTAAAAGG - Intronic
1022934561 7:35158867-35158889 TTAAAGTATTTTGAGGGAAAAGG - Intergenic
1023209254 7:37785396-37785418 CTGAAGTATTTTTAGGAAAGTGG - Intronic
1023217171 7:37875339-37875361 CTGAAGTATTTAGAGGTGATTGG + Intronic
1023691694 7:42795793-42795815 CTGAAGTATTTTGTGGAGGCTGG + Intergenic
1024418976 7:49140205-49140227 CTGAATTGTTTTTTGGTAGAAGG - Intergenic
1025039886 7:55632526-55632548 CCAAAGTATTTTGAGGTTCATGG - Intergenic
1026224855 7:68431343-68431365 CAGAAGGATTCTTAGGTAGAAGG - Intergenic
1028509373 7:91606438-91606460 CAAAAGTATTTTGAGGAAAACGG - Intergenic
1029830502 7:103251646-103251668 TTGAAGTATTTTGAGGGAAAAGG - Intergenic
1030577716 7:111311103-111311125 ATGAAGGATATTGTGGTAGAAGG - Intronic
1030714582 7:112792458-112792480 CTGAAGTATTCTAAAGTATAAGG - Intergenic
1031496335 7:122453237-122453259 CTCAAGTATTTTTAGGAAGGAGG + Intronic
1032844453 7:135740619-135740641 CTGAATTGTTTTATGGTAGAAGG - Intronic
1034540206 7:151753365-151753387 CTGAAATATTTAGGGGTAAAGGG + Intronic
1034717145 7:153254080-153254102 CTGAAGTGTTTTGGTGTGGAGGG + Intergenic
1036060612 8:5314962-5314984 GTGAAGTATTTTCAGTTGGAAGG + Intergenic
1036515417 8:9439253-9439275 CTGAACTATTATGAGGCACATGG - Intergenic
1036531086 8:9588089-9588111 CTGAAGTATTTTGAGATTTGGGG + Intronic
1036717319 8:11137996-11138018 CTGATGTCTTCCGAGGTAGAAGG - Intronic
1041311679 8:56523844-56523866 CATAAGTATATTGAGGTAGCAGG + Intergenic
1042360103 8:67872660-67872682 CTCTAGTTTCTTGAGGTAGAAGG - Intergenic
1043121172 8:76326558-76326580 CTGAACTGTTTGGAGGTAAAAGG - Intergenic
1043556899 8:81440840-81440862 ATAAAGTATTTTGAGGTAAAGGG - Exonic
1043694132 8:83198780-83198802 CTGAAGTCTTATGATTTAGAAGG + Intergenic
1043772409 8:84222002-84222024 TTTAAATATTCTGAGGTAGATGG + Intronic
1044366589 8:91354585-91354607 CTTGAGTAGTTTGAGGAAGATGG + Intronic
1044570121 8:93708820-93708842 TTGAGGTATTTTGAGTTAGCAGG - Intronic
1045939639 8:107724897-107724919 CTGAAGCATTTAAAGGTACATGG + Intergenic
1046112877 8:109748000-109748022 CTGAAATAATTTGAGTTATATGG - Intergenic
1046452308 8:114409670-114409692 CTCAAGTATTTGGAGGTTAATGG + Intergenic
1048121396 8:131585588-131585610 TTGAAGTATTTTGAGATCCATGG + Intergenic
1048627383 8:136200145-136200167 CAAAAGTGTTTTGAGGCAGAGGG + Intergenic
1048902383 8:139051133-139051155 CTGCAGGATTTTGAGACAGAAGG + Intergenic
1051754933 9:20388884-20388906 CTGATATATGTTGAGGGAGATGG - Intronic
1051788858 9:20776660-20776682 CAGAAGTATTTTTAAGTGGATGG - Intronic
1051807252 9:21008682-21008704 CTAAATTATTTTGAGGGAGGGGG + Intronic
1052123408 9:24746207-24746229 CAGGAGAATTTTGAGGAAGAAGG - Intergenic
1053546466 9:39028105-39028127 CAGAAGTGATTTGAGGGAGAAGG - Intergenic
1053711632 9:40816538-40816560 TTGAAGTGTTTTGAGGCATATGG + Intergenic
1053810783 9:41849772-41849794 CAGAAGTGATTTGAGGGAGAAGG - Intergenic
1054422097 9:64948414-64948436 TTGAAGTGTTTTGAGGCATATGG + Intergenic
1054619810 9:67337667-67337689 CAGAAGTGATTTGAGGGAGAAGG + Intergenic
1055266998 9:74505353-74505375 CTGAAATATTTTGGGGAAGATGG - Intronic
1055324755 9:75117886-75117908 ATGAGCTATTTTGAGGTAGAGGG - Intronic
1055708561 9:79034658-79034680 CTGATGTATTTTTAAGTAGTTGG - Intergenic
1055730955 9:79278923-79278945 ATGAATTATTTGAAGGTAGATGG + Intergenic
1056372464 9:85970855-85970877 CTGAAGTGTTTAGAAGTAAAGGG + Intronic
1057827895 9:98385036-98385058 TTGATGGTTTTTGAGGTAGATGG + Intronic
1058209228 9:102146780-102146802 CTAAAGTATGTAGACGTAGAAGG - Intergenic
1058683288 9:107458559-107458581 CTGAAGTATTTAGGGGTGAAAGG - Intergenic
1059009557 9:110441866-110441888 CTGAAGCATTTTAAGATGGATGG - Intronic
1059194411 9:112357183-112357205 ATGAAGTATTAAAAGGTAGAGGG - Intergenic
1060558429 9:124522364-124522386 CTTTTGTATTTTGAGGGAGAGGG - Exonic
1185917846 X:4056037-4056059 CTGAAATATTTAGGAGTAGAAGG - Intergenic
1187121181 X:16407895-16407917 CTGATGTATTTTGAGTTGGCTGG + Intergenic
1187603084 X:20854139-20854161 CTGAAGTATATAGGGGTAAAGGG - Intergenic
1187764456 X:22624564-22624586 CTGAAGTATTTAGAGATAATGGG + Intergenic
1188479952 X:30627358-30627380 CTGACTTATTTTGGGGAAGAGGG - Intergenic
1189002333 X:36959497-36959519 CTGAAATATTTAGGGGTACAGGG + Intergenic
1189161953 X:38818400-38818422 CTGAAGTATTTATGGGTACAGGG + Intergenic
1189396412 X:40627060-40627082 CTGAAGGGAATTGAGGTAGAGGG - Intronic
1190070185 X:47273117-47273139 CTGGAGTGTTTTTGGGTAGAAGG + Intergenic
1190406591 X:50094029-50094051 CTGAAGTGTTTGGGGGTAGAGGG - Exonic
1190461455 X:50680574-50680596 CTGAAGTATTTAGAGGTAAAGGG - Intronic
1191105458 X:56769408-56769430 CTTGAGTATTTTGGGGGAGAAGG + Intergenic
1191106451 X:56774810-56774832 CTTGAGTATTTTGGGGGAGAAGG + Intergenic
1191107444 X:56780212-56780234 CTTGAGTATTTTGGGGGAGAAGG + Intergenic
1192421182 X:71032701-71032723 CTGAAGTATTTAGGAGTATAGGG + Intergenic
1192461630 X:71322014-71322036 ATGAAGTTTTTAGAAGTAGAAGG + Intergenic
1192615258 X:72614178-72614200 CTGAATTATTTAGGGTTAGATGG + Intronic
1194871769 X:99141222-99141244 CAGAAGGACTTTCAGGTAGAAGG - Intergenic
1195513870 X:105749192-105749214 CTGAAATATTTAGGGGTAAAGGG + Intronic
1195596742 X:106699746-106699768 TTGAAGCATTGTGAGGGAGAGGG - Intronic
1195865506 X:109428723-109428745 CTGAAGTATTTAGAGGTAAAAGG + Intronic
1196134685 X:112195564-112195586 CCGTAGTGTTTTGAGTTAGAGGG - Intergenic
1196769364 X:119278470-119278492 CTGAAGTATTTAAAGTTAAATGG - Intergenic
1197224719 X:123945549-123945571 CTGAAATATTTAGGGGTAAAAGG - Intergenic
1197668552 X:129250059-129250081 CTGAAGTATTAAGGGGTAAAGGG - Intergenic
1197927339 X:131660697-131660719 CTGAAGTATTTAGGGTTAAATGG - Intergenic
1199365881 X:146982174-146982196 CTGTATTATTTGAAGGTAGATGG - Intergenic
1199719736 X:150534200-150534222 CTGAAGGATTTTAAGCAAGAAGG + Intergenic
1199975324 X:152891777-152891799 CTGGACTATTCTGAGGTAGCTGG + Intergenic
1200298583 X:154948440-154948462 CTAAAGTATTGAGAGGTAAAGGG + Intronic
1200834238 Y:7717523-7717545 CAAAAGTATTTTGGGGTTGAAGG + Intergenic
1201683021 Y:16669970-16669992 TTTAAGGATTTTGAGGTGGATGG + Intergenic
1201950991 Y:19563719-19563741 CTGAAGTGTTATGTGGAAGATGG + Intergenic