ID: 981977675

View in Genome Browser
Species Human (GRCh38)
Location 4:150750295-150750317
Sequence TTGATTATAATCCATGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 291}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981977675 Original CRISPR TTGATTATAATCCATGTGCC AGG (reversed) Intronic
900687389 1:3957395-3957417 TTGAATATAAACCATGTTGCAGG - Intergenic
903273291 1:22205430-22205452 TTGATCATCACCCACGTGCCAGG - Intergenic
906955288 1:50369058-50369080 TTGAATGTTAGCCATGTGCCAGG - Intergenic
908481690 1:64546759-64546781 TTGATTTTAATGCAAGAGCCAGG - Intronic
909922198 1:81396120-81396142 TTAATTCTAATCCATGAGCATGG + Intronic
910022224 1:82605755-82605777 TTGATTATCTTCTATGTGCTGGG - Intergenic
910890659 1:92016325-92016347 TTGATTATCTGCAATGTGCCAGG - Intergenic
911692630 1:100851655-100851677 TTGATTATCCACTATGTGCCAGG + Intergenic
912015190 1:105025986-105026008 TTGTTTATAATTCTTGTGCTTGG - Intergenic
913695248 1:121318416-121318438 TTCATTTTAATCAAGGTGCCAGG + Intronic
914142316 1:144961644-144961666 TTCATTTTAATCAAGGTGCCAGG - Intronic
914700743 1:150130823-150130845 TTGAATATATACTATGTGCCAGG + Intronic
915228455 1:154428584-154428606 TCCATTATATTCCAAGTGCCCGG - Intronic
915293216 1:154900371-154900393 TTGACTATGACCGATGTGCCAGG - Intergenic
915682885 1:157598688-157598710 TTGATTGAAATACATATGCCTGG + Intergenic
916391478 1:164335634-164335656 TTTATTATATTCCATGGCCCAGG - Intergenic
916440162 1:164816975-164816997 ATGATTATAATGCATTTGCTTGG - Intronic
916930316 1:169571574-169571596 TTGAGTGTCATCTATGTGCCAGG + Intronic
917344027 1:174009876-174009898 TTGAGTACACTCTATGTGCCAGG + Intronic
917748151 1:178030500-178030522 TTGATTAAAAATCATGTGCAAGG - Intergenic
917786751 1:178467157-178467179 TTGATTTTTCTCCTTGTGCCTGG - Intronic
919706792 1:200684059-200684081 TTGAGTATTTTCTATGTGCCAGG + Intergenic
920041423 1:203100140-203100162 CTGATAAAAATCCTTGTGCCTGG - Intronic
920439488 1:205969785-205969807 TTGAGTATCTACCATGTGCCGGG + Intergenic
920482579 1:206336795-206336817 TTCATTTTAATCAAGGTGCCAGG + Intronic
922130142 1:222769540-222769562 TTGATCATTTTTCATGTGCCAGG + Intergenic
922183830 1:223257092-223257114 TAGAATATAAAGCATGTGCCGGG + Intronic
1063740441 10:8812592-8812614 TTGCTTACAATCCATGAGCATGG - Intergenic
1064121983 10:12627378-12627400 TAAATTATAACCCATATGCCAGG - Intronic
1064621675 10:17223832-17223854 TTGAGTATTTGCCATGTGCCGGG - Intergenic
1064750287 10:18521562-18521584 TTGAGTATATTCTATGTGCCAGG + Intronic
1064959478 10:20947613-20947635 TTGTTTATTATCATTGTGCCAGG + Intronic
1066351326 10:34639941-34639963 ATGAATATAACCCATGTGCTAGG - Intronic
1067529048 10:47057289-47057311 TGAATCATATTCCATGTGCCTGG - Intergenic
1068396872 10:56473675-56473697 TTGATTTTTATACATGTGACTGG + Intergenic
1068521844 10:58085561-58085583 TTGAGTGTGATCTATGTGCCAGG + Intergenic
1071474834 10:86017245-86017267 TTGATACTTACCCATGTGCCCGG - Intronic
1071988655 10:91077369-91077391 TTGAGTTTATTCCATGAGCCGGG + Intergenic
1072155019 10:92716219-92716241 TTGATTGTTTTCTATGTGCCAGG + Intergenic
1073905139 10:108270652-108270674 TTGGGAATAATCCATGTGCTGGG + Intergenic
1074710472 10:116173067-116173089 TGGAATATATTCTATGTGCCTGG + Intronic
1075072194 10:119326816-119326838 TTGAATATATGGCATGTGCCGGG + Intronic
1078350474 11:10588843-10588865 TTGAGTACATTCTATGTGCCTGG + Intronic
1080014618 11:27491393-27491415 TTCCTTATGATCCATGGGCCTGG - Intergenic
1081209751 11:40318071-40318093 TTGATTATTATCAATGTTCTCGG - Intronic
1082126440 11:48436445-48436467 TTGATTTTAATTCAAGTCCCAGG - Intergenic
1082560026 11:54607520-54607542 TTGATTTTAATTCAAGTCCCAGG - Intergenic
1083792360 11:64994252-64994274 TTGAGTACAAACCATGTGCCAGG - Intronic
1084907772 11:72361525-72361547 TTGATTGTAATCAATCTGCTTGG - Intronic
1085450937 11:76632105-76632127 TTGATTAGACTCAATGTGCTAGG + Intergenic
1085652952 11:78284857-78284879 TTGATTACTAGCTATGTGCCAGG - Intronic
1085664855 11:78405397-78405419 CTCATTAAAATCCATGTGCTTGG - Intronic
1087767545 11:102172635-102172657 TTGAATACAAACTATGTGCCAGG + Intronic
1088853025 11:113720961-113720983 TTGAGAATATTCTATGTGCCAGG + Intergenic
1089141184 11:116285764-116285786 TTGATTACCATCTATGTGGCAGG + Intergenic
1090519971 11:127468306-127468328 TACATTAAAATCCATGGGCCTGG + Intergenic
1090821036 11:130341859-130341881 CTGAGTATATGCCATGTGCCAGG - Intergenic
1091808178 12:3371442-3371464 TTAAATAAAATCCATGTTCCAGG - Intergenic
1092942918 12:13427182-13427204 TTGATTACTTTCCATATGCCCGG - Intergenic
1093133224 12:15417142-15417164 TTGTTTTTTAACCATGTGCCGGG - Intronic
1093903035 12:24658142-24658164 TTGAAAATAATCCATGTGTTGGG + Intergenic
1094719357 12:33047638-33047660 TTATTCATAATCCATTTGCCTGG + Intergenic
1096279986 12:50244577-50244599 TTAATTACAATCAGTGTGCCAGG - Intronic
1097319635 12:58210898-58210920 TTGAATATATTCCATGAGACAGG + Intergenic
1098169849 12:67736375-67736397 TTTATTGTTTTCCATGTGCCAGG + Intergenic
1098886281 12:75963920-75963942 TTGAGTATATTCCCTGTGCCAGG + Intergenic
1099020844 12:77402228-77402250 TTGATTTTAAATTATGTGCCTGG - Intergenic
1099551172 12:84044967-84044989 ATGATTAAAATTTATGTGCCTGG + Intergenic
1100202367 12:92313078-92313100 TTGAGTATTATCCTTGTGCCAGG + Intergenic
1101354518 12:103964774-103964796 TTGAATATTTACCATGTGCCAGG + Intronic
1101503893 12:105329651-105329673 TTTATTTTAATCTATCTGCCTGG + Intronic
1102142860 12:110630806-110630828 TTGAGCATTTTCCATGTGCCAGG + Intronic
1102168637 12:110825300-110825322 TTGAGTATGTGCCATGTGCCAGG + Intergenic
1102729368 12:115094493-115094515 TTGAGTATTTCCCATGTGCCGGG + Intergenic
1103890162 12:124232469-124232491 TTTATAATCATCCAGGTGCCAGG + Intronic
1105981616 13:25522082-25522104 TTAATTCTAATCCATGAGCATGG + Intronic
1106587627 13:31071222-31071244 TTGAGTATTTACCATGTGCCAGG + Intergenic
1107795647 13:44048802-44048824 TTGATGACAGTCCATGTGCTGGG - Intergenic
1108173405 13:47767486-47767508 TTGTTTAAAATGCATGTGCCTGG - Intergenic
1108334969 13:49430932-49430954 TTGATAATAATTCATGTGAAAGG - Intronic
1109220479 13:59636347-59636369 TTTATTATAATGCATCTGCATGG - Intergenic
1110671324 13:78182357-78182379 TTAATTATCATCTATGTGCAAGG - Intergenic
1111498226 13:89082510-89082532 TAGATTATAAGCCATCTGCCTGG + Intergenic
1111731931 13:92087388-92087410 TTAAATATAAACCATGTACCAGG - Intronic
1112164252 13:96900803-96900825 ATGATTACAATCCAGCTGCCAGG - Intergenic
1113002830 13:105662725-105662747 TTGATCTTATTCCATCTGCCTGG + Intergenic
1115184763 14:30673862-30673884 TTGATTTTTATGCTTGTGCCTGG + Intronic
1116893962 14:50297625-50297647 TTGAGAATGATCCATGTGCTGGG - Intronic
1118481536 14:66172177-66172199 TTGTATATAATCCATATGCCTGG + Intergenic
1118691028 14:68340052-68340074 TTGAATACTAACCATGTGCCAGG - Intronic
1119649736 14:76375188-76375210 TTGATTATTATCCCTGTGGCTGG + Intronic
1121616619 14:95318285-95318307 TTGATAATAAGCCAAGTGCCTGG - Intronic
1124534020 15:30528890-30528912 TTGATTATTTTTCATGTGGCTGG + Intergenic
1124764627 15:32478720-32478742 TTGATTATTTTTCATGTGGCTGG - Intergenic
1125291713 15:38156170-38156192 TTTCTTCTAATCCATGAGCCTGG - Intergenic
1125339223 15:38658179-38658201 TTGAATATCTACCATGTGCCAGG - Intergenic
1126404934 15:48313996-48314018 TTGAATGTGTTCCATGTGCCAGG - Intergenic
1126497216 15:49305307-49305329 TTGATCATCATTCATGTGGCAGG + Intronic
1127140696 15:55973191-55973213 TTGAGAATGATCCATATGCCAGG - Intronic
1127326211 15:57897451-57897473 ATGATTATAACCCATGTCTCCGG + Intergenic
1129964165 15:79719041-79719063 TTGTTTATTATTTATGTGCCAGG - Intergenic
1130696715 15:86138729-86138751 TTGATTATAAATCATGAGCAAGG - Intergenic
1131209129 15:90478370-90478392 TTGAGTATTAACTATGTGCCAGG + Intronic
1131398151 15:92103253-92103275 TTGATAATAAACCATGCCCCTGG - Intronic
1131414303 15:92239622-92239644 TTGATTCCAATCCATGAGCATGG - Intergenic
1133826159 16:9280125-9280147 TTGAGTACCTTCCATGTGCCAGG - Intergenic
1134339188 16:13329433-13329455 CAGATTAAAATCCATGTGCTAGG + Intergenic
1135500094 16:22988779-22988801 TTAAATATATACCATGTGCCAGG + Intergenic
1140240303 16:73193884-73193906 TTGAGTGTATACCATGTGCCAGG - Intergenic
1140879052 16:79180942-79180964 TGTATTAAAATGCATGTGCCTGG - Intronic
1140963404 16:79940174-79940196 TTCTTTATCATCCAAGTGCCTGG - Intergenic
1144959146 17:19035080-19035102 TTGATTAGGTGCCATGTGCCAGG - Intronic
1144976013 17:19139444-19139466 TTGATTAGGTGCCATGTGCCAGG + Intronic
1146458454 17:33025207-33025229 TTGATTATAAGCCATTTCCTGGG + Intronic
1148875590 17:50685006-50685028 TTGAGCATATTCCGTGTGCCAGG + Intronic
1149125396 17:53224117-53224139 ATTATTTTAATCCATGAGCCTGG + Intergenic
1149217822 17:54378478-54378500 TTGAGTATTATCTATGTACCAGG + Intergenic
1149774381 17:59345791-59345813 TTGAGTATTAGCCATGTGCTGGG + Intronic
1149946075 17:60929147-60929169 GGGATTATAAGCAATGTGCCCGG - Intronic
1149985655 17:61345013-61345035 TGGATTATAAACCATCCGCCTGG + Intronic
1151086392 17:71385977-71385999 TTGAGTATCTACCATGTGCCAGG - Intergenic
1153913528 18:9724796-9724818 CTGAGTATAACTCATGTGCCAGG + Intronic
1154071307 18:11154664-11154686 TTGATTATAGCCCATGTTGCAGG + Intergenic
1155421021 18:25655904-25655926 TTGATTATTTACCATGTGCCAGG - Intergenic
1156670546 18:39464278-39464300 TTGATTTTTCTCCATGTGCAAGG + Intergenic
1156753999 18:40497642-40497664 TGGCTTAAAGTCCATGTGCCTGG + Intergenic
1157241756 18:46016492-46016514 TTGACCATAAACCATGGGCCAGG + Intronic
1162045190 19:7994624-7994646 TGGATTTTATTCCATGTGACTGG - Intronic
1163869914 19:19812076-19812098 TTGTTTATCATCCAAGTACCAGG + Intronic
1163874347 19:19854341-19854363 TTGTTTATCATCCAAGTACCAGG + Intergenic
1163909936 19:20180286-20180308 TTGTTTATCATCCAAGTACCAGG - Intronic
1163930441 19:20385417-20385439 TTGTTTATCATCCAAGTACCAGG - Intergenic
1163932831 19:20414186-20414208 TTGTTTATCATCCAAGTACCAGG + Intergenic
1163975708 19:20850004-20850026 TTGTTTATTATCCAAGTACCAGG + Intronic
1164821818 19:31256632-31256654 TTGGTTATCTACCATGTGCCAGG + Intergenic
1165215032 19:34264991-34265013 TTGATTATGTTCCTTGTGTCTGG + Intronic
1165216454 19:34277239-34277261 TTGATTTTATTCAAAGTGCCAGG + Intronic
1166352870 19:42208591-42208613 TGGATTTTATTCCATGCGCCAGG - Intronic
925326596 2:3026862-3026884 TGTATTATATTCCATGTGTCGGG + Intergenic
925632193 2:5905896-5905918 TTGAGTATCTACCATGTGCCAGG - Intergenic
925997317 2:9304021-9304043 TTTATTAGAAGACATGTGCCGGG + Intronic
927333825 2:21897328-21897350 TTAATTATAATCCATAGGCTGGG + Intergenic
927345572 2:22034846-22034868 TTGATCACTATCTATGTGCCAGG - Intergenic
927609193 2:24520529-24520551 TTGATTAAGATGCATGTTCCTGG - Intronic
928268585 2:29833637-29833659 TTGACTATATTGCATGTTCCAGG + Intronic
930378286 2:50595390-50595412 TTGATTATGATTTATGGGCCAGG + Intronic
930782742 2:55239113-55239135 TATATTATAATCCATGATCCTGG + Intronic
931013178 2:57942766-57942788 TTTAATATTATCCAGGTGCCAGG + Intronic
931547549 2:63406388-63406410 TTGAATATGAGCCATGTGCCAGG + Intronic
932071648 2:68626527-68626549 TTGATTACCCTCTATGTGCCAGG - Intronic
932160047 2:69451523-69451545 TTGATTTTATTCCTAGTGCCTGG + Intergenic
933631080 2:84659147-84659169 TTGATGATAATCCTGATGCCAGG + Exonic
933672231 2:85019641-85019663 TTAATAATAATCTATGTGGCAGG - Intronic
935502026 2:103853269-103853291 TTGAATATTATGCTTGTGCCTGG + Intergenic
936660664 2:114539705-114539727 TTGAGTATATTCTTTGTGCCAGG - Intronic
937107909 2:119336092-119336114 TTGATTAATATCCATTTCCCAGG + Intronic
937591601 2:123619478-123619500 TTGAAAATGATCCATGTGCTGGG - Intergenic
939332936 2:140787948-140787970 TTGAAAATCACCCATGTGCCTGG - Intronic
941677514 2:168359666-168359688 TTTATTATTATCTATGTTCCTGG - Intergenic
942895298 2:181046088-181046110 CTGATTATCTACCATGTGCCAGG - Intronic
944544453 2:200785162-200785184 TTGAGTACCTTCCATGTGCCAGG + Intergenic
944595154 2:201254528-201254550 TTGTATATAACCCATGGGCCAGG - Intronic
947538565 2:230957663-230957685 TTGAAAATATTCCCTGTGCCCGG + Intronic
1168852366 20:985374-985396 TTGAATATCATCTATGTGCCAGG + Intronic
1170941380 20:20850992-20851014 TTGCTCTTAATCCATCTGCCAGG - Intergenic
1173099235 20:40068713-40068735 TTGAGAATGATCCATGTGCTGGG - Intergenic
1174774673 20:53332804-53332826 TTTCTTATAATGCATCTGCCAGG - Intronic
1181830655 22:25557950-25557972 TTGAGTATCATCAATGTGGCAGG - Intergenic
1182410594 22:30181798-30181820 TTGATTGCCTTCCATGTGCCAGG - Intergenic
1183556391 22:38530604-38530626 TTGATTACTTACCATGTGCCAGG - Intronic
1184171123 22:42760450-42760472 ATGCCTGTAATCCATGTGCCTGG + Intergenic
951055723 3:18144503-18144525 TTGACTATAAGCCATGTACTAGG + Intronic
951697299 3:25458964-25458986 TTGATTATCTGCCATGTGCCAGG + Intronic
951844614 3:27072224-27072246 ATATTTATAAACCATGTGCCTGG - Intergenic
952537032 3:34321925-34321947 TTGATTATATTCCATTTTTCTGG + Intergenic
953113287 3:39965615-39965637 TTGACCATAATCCATGAGTCAGG + Intronic
956897551 3:73678851-73678873 ATTATTATAATCCATTTTCCAGG + Intergenic
957211216 3:77261041-77261063 TTGATTAGAAACCGTGAGCCTGG - Intronic
957754097 3:84465071-84465093 TTGAAAATGATCCATGTGGCTGG - Intergenic
957888599 3:86325091-86325113 ATTATTCTAATCCATGTGCATGG - Intergenic
960510731 3:118545837-118545859 TTGATTATTTGCCATGTGACAGG - Intergenic
961585190 3:127916194-127916216 GTCTTTATCATCCATGTGCCTGG + Intronic
961606496 3:128099282-128099304 TTGAGTCTATTCCATCTGCCAGG + Intronic
962514308 3:136135698-136135720 TTTATCATGAGCCATGTGCCAGG - Intronic
962617992 3:137147761-137147783 ATGATTGTAATGCTTGTGCCTGG + Intergenic
963278080 3:143352823-143352845 TTGAAAATAATCCATGATCCAGG - Intronic
963680856 3:148374649-148374671 TTCATTATAATCCATATGTATGG + Intergenic
964061082 3:152523662-152523684 TTGAATATAATCAATTTGCTTGG + Intergenic
965174937 3:165319336-165319358 TTGAGAATGATCCATGTGCTGGG + Intergenic
965273947 3:166656349-166656371 TTGAGGATTATCCATGTGCTGGG - Intergenic
965354231 3:167654494-167654516 TTGAGTATTAACCATGTGCCAGG + Intergenic
965358955 3:167713152-167713174 TTGAGAATGATCCATGTGCTGGG - Intronic
966049794 3:175601458-175601480 TTGAATATAATGCATGTGTCAGG + Intronic
966236718 3:177709434-177709456 TTGAGCATCAACCATGTGCCAGG - Intergenic
967343251 3:188424567-188424589 TTGATTCTTATCCATGAGCATGG + Intronic
967346347 3:188460540-188460562 TTGATTTTATTCCTTGTGCAGGG + Intronic
967402729 3:189082000-189082022 TTGATAATAAGCCATCTACCTGG + Intronic
971432859 4:26586870-26586892 TTCATTATGATACATGTACCTGG - Intronic
971497249 4:27280087-27280109 TTAATTCTTATCTATGTGCCAGG - Intergenic
972410232 4:38786356-38786378 TTGACTGTAAGCCATGAGCCTGG - Intergenic
972836613 4:42878290-42878312 TTGATTATGAGCTCTGTGCCTGG - Intergenic
972902018 4:43696904-43696926 TTGAGAATGATCCATGTGCTGGG + Intergenic
972996841 4:44890642-44890664 TTGAGAATGATCCATGTGCTGGG + Intergenic
973645582 4:52948257-52948279 CTGATTAAGAGCCATGTGCCAGG - Intronic
974290931 4:59929226-59929248 TTGAAAATAATTCATGTGCTGGG - Intergenic
976010503 4:80481894-80481916 TTGAATATTAGCCATGTACCAGG - Intronic
976244548 4:82994190-82994212 TTCTTTATTATCCATGTGTCAGG - Intronic
977226600 4:94399185-94399207 TTTATTATGTGCCATGTGCCAGG - Intergenic
980924653 4:139122882-139122904 TACATTAAAATCCATGAGCCAGG + Intronic
981264045 4:142759671-142759693 TTGATTGTTTACCATGTGCCTGG - Intronic
981977675 4:150750295-150750317 TTGATTATAATCCATGTGCCAGG - Intronic
982788499 4:159563284-159563306 TTGGGTTTATTCCATGTGCCAGG + Intergenic
986567974 5:9134489-9134511 TTCATTATAAACCAAGTGCGTGG + Intronic
986807228 5:11319285-11319307 TTGAGTATAAACCATGGGCTTGG - Intronic
987133388 5:14879809-14879831 TTGAGCATTTTCCATGTGCCAGG + Intergenic
987328718 5:16835871-16835893 TTTATTATGATCCATGTACTGGG - Intronic
988300868 5:29424479-29424501 TGTATTAAAATCCATGGGCCAGG - Intergenic
988960971 5:36371530-36371552 TGGATTATAATCGGTATGCCAGG + Intergenic
990044133 5:51408207-51408229 ATGGTTATCATCTATGTGCCAGG + Intergenic
990278900 5:54228976-54228998 TTTATTCTAATCCATGTTTCTGG + Intronic
990363604 5:55047059-55047081 TTGAGTATCTACCATGTGCCAGG - Intergenic
993278346 5:85891462-85891484 TTGAGTATTTTCTATGTGCCAGG - Intergenic
993511174 5:88773173-88773195 TTGAGTGTCATCCATGTGCTGGG - Intronic
995262444 5:110121042-110121064 TTGAGAATAATTCATGTGCTGGG + Intergenic
995948652 5:117682337-117682359 TTGAATAATAACCATGTGCCAGG - Intergenic
995976207 5:118038333-118038355 TTGATTATATTCCATGGTCAAGG + Intergenic
996347762 5:122505613-122505635 TTGATCATCTACCATGTGCCAGG + Intergenic
997261723 5:132470438-132470460 TTGATTATCTGCCATATGCCTGG + Intronic
998173248 5:139884758-139884780 TTGAGTATCAACTATGTGCCAGG - Intronic
998711474 5:144830388-144830410 CTGAAAATAATCCTTGTGCCAGG - Intergenic
999115168 5:149156404-149156426 CTGAGTATTTTCCATGTGCCAGG - Intronic
999917215 5:156275905-156275927 TTGAACATTTTCCATGTGCCCGG + Intronic
1000433013 5:161173663-161173685 TTGAATTTATTCCAAGTGCCAGG + Intergenic
1001727805 5:173921762-173921784 TTGAACATATTCAATGTGCCAGG + Intronic
1001785549 5:174409609-174409631 TTGAGTATCCACCATGTGCCAGG + Intergenic
1003998850 6:11573572-11573594 TGGATTTTAATCCAGGAGCCTGG + Intronic
1005181346 6:23110447-23110469 TTGATTATAATCCATCTTTTGGG + Intergenic
1006591321 6:35160166-35160188 TTGAGTATTTACCATGTGCCAGG + Intergenic
1006796071 6:36733160-36733182 TTGAATATACAACATGTGCCAGG + Exonic
1007442443 6:41874287-41874309 TTGATCATCAGCTATGTGCCAGG - Intronic
1009004102 6:57760384-57760406 TGTATTAAAATCCATGGGCCAGG - Intergenic
1010510312 6:76710110-76710132 TTGCTTACAATCACTGTGCCAGG - Intergenic
1010967568 6:82229305-82229327 TTGAGCATATTCCATTTGCCAGG - Intronic
1011232321 6:85176576-85176598 TTGAGAATGATCCATGTGCTGGG + Intergenic
1011343480 6:86343437-86343459 TTGACAATGATCCATGTGCGAGG - Intergenic
1012715535 6:102664110-102664132 TTGAGAATGATCCATGTGCTGGG - Intergenic
1012952971 6:105538671-105538693 TTGAGGATCTTCCATGTGCCAGG - Intergenic
1013377557 6:109532548-109532570 TTGATTTTTATCCATGTTACAGG + Intronic
1013918623 6:115371927-115371949 GTGAGTCTAGTCCATGTGCCAGG - Intergenic
1015393021 6:132704268-132704290 TTGAGAATGATCCATGTGCTGGG - Intronic
1015450480 6:133361803-133361825 ATGATTGTAATCCAAGTACCTGG + Intronic
1017260272 6:152377739-152377761 TTTCTTATAATCCATGAGTCTGG + Intronic
1022130061 7:27396822-27396844 TTGGTTTTAAACCATGTGCACGG + Intergenic
1022349014 7:29549052-29549074 TTGGTTATGCTCCATTTGCCAGG - Intergenic
1022630563 7:32080405-32080427 TTGAGTATAATGTATGTGCTAGG - Intronic
1028364821 7:90015768-90015790 GTGATTATAACCCATATACCAGG - Intergenic
1028527195 7:91799722-91799744 TTGATTACCTACCATGTGCCAGG + Intronic
1030748301 7:113196606-113196628 TTGACAATGATCCATGTGCAAGG + Intergenic
1031103051 7:117506059-117506081 TTGAGTATATACCATATGCCAGG - Intronic
1031454372 7:121961245-121961267 CAGATTATGATCCATGTGCCTGG - Intronic
1032717881 7:134526477-134526499 TTAATAATAATGCATGGGCCGGG - Intergenic
1032954178 7:136951240-136951262 TTCTTTGTCATCCATGTGCCTGG - Intronic
1033041594 7:137924147-137924169 ATGATTCTTATCCATGTTCCTGG + Intronic
1033764625 7:144474832-144474854 TGGAGTATATTTCATGTGCCAGG - Intronic
1033996118 7:147350802-147350824 TTGTTCCTAGTCCATGTGCCTGG + Intronic
1034750327 7:153562243-153562265 TAGATCATAAACCAGGTGCCGGG - Intergenic
1036961608 8:13250119-13250141 TTGATCCTATTCCATGTTCCAGG - Intronic
1037858064 8:22385698-22385720 TAGATTTTATTCCATGTGGCTGG + Intronic
1039013400 8:33120868-33120890 CTGAGTATATTCCATGTGACTGG + Intergenic
1041267929 8:56083096-56083118 TTGATTGTATTCCCAGTGCCCGG + Intergenic
1041882170 8:62764216-62764238 CTGAACATATTCCATGTGCCTGG + Intronic
1043133794 8:76495452-76495474 TTGAGAATGATCCATGTGCTAGG + Intergenic
1043376351 8:79654099-79654121 TTGATAACAATGCAGGTGCCTGG - Intronic
1043567611 8:81565393-81565415 TTGAGAATGATCCATGTGCTGGG - Intergenic
1044201029 8:89437024-89437046 TTTAGTATTAACCATGTGCCTGG - Intergenic
1046086316 8:109440181-109440203 TTGGTTATAATGCATCTGCTAGG - Intronic
1046131012 8:109968755-109968777 TAAATCATAATCCTTGTGCCAGG + Intronic
1046565370 8:115892895-115892917 TTGAGTGTCTTCCATGTGCCAGG + Intergenic
1046979453 8:120321005-120321027 AGGATTTTAATCCATCTGCCTGG + Intronic
1048441451 8:134462441-134462463 TTGACTGTTCTCCATGTGCCAGG - Intergenic
1051394331 9:16602833-16602855 ATGATAAAAATCCATGTTCCTGG - Intronic
1051593276 9:18797807-18797829 TTGAGTATGAACAATGTGCCTGG - Intronic
1055149182 9:72974721-72974743 ATGATTCTATTCCATGTGCCTGG + Intronic
1055766026 9:79664430-79664452 TTGGTTATAATCCCTGAGGCGGG - Intronic
1056156330 9:83842005-83842027 TTGATTGTCTGCCATGTGCCAGG - Intronic
1056354199 9:85781576-85781598 TTGATTGTCTGCCATGTGCCAGG + Intergenic
1057569230 9:96191265-96191287 TTGAGTATTTGCCATGTGCCAGG - Intergenic
1057981146 9:99665094-99665116 TTGAGTATCTACCATGTGCCAGG + Intergenic
1059552815 9:115246991-115247013 TTGATTATCATATATCTGCCTGG - Intronic
1059614351 9:115932516-115932538 TTGAATAGATTCTATGTGCCAGG + Intergenic
1059617853 9:115970142-115970164 TTGATTATCTTCTATGTACCAGG - Intergenic
1187654468 X:21454520-21454542 TTGATCAATATCCATGTTCCAGG - Intronic
1187963603 X:24589036-24589058 TTGAGTATTTACCATGTGCCCGG - Intronic
1188170137 X:26914120-26914142 TTAATAAAAATCCATATGCCTGG - Intergenic
1188425465 X:30042021-30042043 TTGAATACATACCATGTGCCAGG - Intergenic
1188515336 X:30979784-30979806 TTTATTAAATGCCATGTGCCAGG - Intergenic
1189439708 X:41024373-41024395 AAGATCATAATCCAGGTGCCAGG + Intergenic
1192411068 X:70932673-70932695 TTGAGTACTTTCCATGTGCCAGG - Intergenic
1193361132 X:80580295-80580317 TTGAGGATGATCCATGTGCTAGG + Intergenic
1193733936 X:85134415-85134437 TTGATTACCTTCTATGTGCCAGG + Intergenic
1194290743 X:92068911-92068933 TTGAGAATGATCCATGTGCAGGG + Intronic
1196670712 X:118364579-118364601 TTGGTTATCTACCATGTGCCAGG - Intronic
1197134361 X:123043799-123043821 TTGAATATTTTCAATGTGCCAGG - Intergenic
1199210806 X:145207447-145207469 TTGAGAATGATCCATGTGCTCGG - Intergenic
1199327607 X:146517927-146517949 TTGAGAATTATCCATGTGCTGGG + Intergenic
1199454752 X:148015750-148015772 TTGAGGATAATTCATGTGCTGGG + Intronic
1199763825 X:150926107-150926129 TAGAGTATAATCCATTTTCCTGG - Intergenic
1199892310 X:152098220-152098242 TTTATTATACTCCATTTACCAGG + Intergenic
1200608256 Y:5293501-5293523 TTGAGAATGATCCATGTGCAGGG + Intronic