ID: 981979564

View in Genome Browser
Species Human (GRCh38)
Location 4:150774704-150774726
Sequence GGTTACTTCTAACCTTGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981979560_981979564 14 Left 981979560 4:150774667-150774689 CCTGACATTGTGAAAAGACACAT 0: 1
1: 2
2: 14
3: 33
4: 247
Right 981979564 4:150774704-150774726 GGTTACTTCTAACCTTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981979564 Original CRISPR GGTTACTTCTAACCTTGTAC TGG Intronic
No off target data available for this crispr