ID: 981982209

View in Genome Browser
Species Human (GRCh38)
Location 4:150807474-150807496
Sequence TCTGGACACTAAGTCTCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981982205_981982209 7 Left 981982205 4:150807444-150807466 CCCAATTGTGGTAAAGAAAATCA 0: 1
1: 0
2: 4
3: 23
4: 333
Right 981982209 4:150807474-150807496 TCTGGACACTAAGTCTCCAGTGG 0: 1
1: 0
2: 0
3: 11
4: 135
981982206_981982209 6 Left 981982206 4:150807445-150807467 CCAATTGTGGTAAAGAAAATCAA 0: 1
1: 0
2: 0
3: 29
4: 560
Right 981982209 4:150807474-150807496 TCTGGACACTAAGTCTCCAGTGG 0: 1
1: 0
2: 0
3: 11
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981982209 Original CRISPR TCTGGACACTAAGTCTCCAG TGG Intronic
902177707 1:14663472-14663494 TCTGAACACTGACTCTGCAGAGG - Intronic
902749221 1:18495388-18495410 TCTGGACACTGGGTCTTCAGAGG + Intergenic
905903141 1:41595476-41595498 TCTGGAGACTAATTCCACAGAGG + Intronic
907917736 1:58886258-58886280 TCTGGAAACCAGCTCTCCAGAGG + Intergenic
908668603 1:66520559-66520581 TTTGGAAACCAAGTCTCCATAGG - Intergenic
909785001 1:79600483-79600505 CCTGGAGACTGAGTCTGCAGGGG - Intergenic
911309758 1:96277967-96277989 CCTGGAGTCTGAGTCTCCAGGGG + Intergenic
912281434 1:108318962-108318984 TTTGGGCACTAAGTCTCTAATGG - Intergenic
912716590 1:111988120-111988142 TGTGGAAAGTAAGTTTCCAGAGG - Intronic
915405485 1:155656903-155656925 TCTGGACGCTTCCTCTCCAGAGG - Intergenic
916999551 1:170341509-170341531 TGAGGAAACTAAGTCTCCAAAGG - Intergenic
918602075 1:186375602-186375624 TCTGGACACTGAGCCACTAGAGG + Intronic
920760694 1:208781231-208781253 TCTGGATTCTAAGTCTCAAAAGG + Intergenic
922757947 1:228106885-228106907 TCTGGACACCCTGTCTCCTGAGG - Exonic
923812848 1:237339628-237339650 TCAGGACACAAAATGTCCAGAGG + Intronic
924077024 1:240350325-240350347 TAGGGATATTAAGTCTCCAGTGG - Intronic
924844239 1:247749648-247749670 TCTGGAGGCTGAGTCTACAGGGG - Intergenic
1068780658 10:60916173-60916195 TCTAGAGTCTAGGTCTCCAGAGG + Intronic
1072367597 10:94729665-94729687 TCTGAAAACTAGGTGTCCAGTGG + Intronic
1073327282 10:102650251-102650273 CCTGGCCAGTCAGTCTCCAGAGG + Intronic
1074513564 10:114142205-114142227 TCTGTACACTAGGTCACCCGAGG - Intronic
1075689863 10:124387544-124387566 TGAGGACACTGAGACTCCAGAGG + Intergenic
1078852570 11:15178145-15178167 TCTGCACACTAAGAGACCAGTGG + Intronic
1080279824 11:30544235-30544257 CCTGGACAATACATCTCCAGTGG - Intronic
1080656243 11:34260729-34260751 GCAGGACACTTAGTCTCCATGGG - Intronic
1081398533 11:42615642-42615664 TCTGGAGATGAAGTCTCCATTGG + Intergenic
1083887974 11:65581974-65581996 TGTGGACACTAAGGGACCAGAGG + Exonic
1085252064 11:75150603-75150625 TCTGTCCACTAAGTATCCAGTGG - Intronic
1085510029 11:77083477-77083499 TCCGGACACCAGGTTTCCAGGGG + Intronic
1089341505 11:117761141-117761163 TCTGAACACCCAGCCTCCAGAGG + Intronic
1090508831 11:127349620-127349642 TCTGGACACTGAAGCTCAAGTGG + Intergenic
1091026769 11:132148458-132148480 TCTCAACACTAAGTGTGCAGGGG - Intronic
1107886879 13:44881034-44881056 TCTAGACACTAAGTTTGCAGAGG - Intergenic
1111588722 13:90315370-90315392 CCTGGACACCAAGTCTTGAGAGG + Intergenic
1111887465 13:94040346-94040368 TCTGGACATTAAGTCCCCCAAGG + Intronic
1114454600 14:22846713-22846735 TCTGCCCACTTAGTCCCCAGTGG - Exonic
1119167757 14:72509394-72509416 TCTAGACAGCAAGGCTCCAGAGG - Intronic
1121736902 14:96225098-96225120 TCAGCACACTGAGTCTGCAGAGG - Intronic
1122526918 14:102393089-102393111 TCTGAAAACCAAGGCTCCAGAGG + Intronic
1123817668 15:23996189-23996211 GCTGGACCCGAAGTCTCCAAAGG + Intergenic
1124996275 15:34726123-34726145 TCTGCACACTAACTGTCCCGGGG + Intergenic
1127158716 15:56157101-56157123 TCTGGATACTAATCCTCTAGTGG + Intronic
1129750939 15:78063566-78063588 TCTGGACATTAAATCTAGAGGGG + Intronic
1136186198 16:28590325-28590347 TCTGGCCACGTAGTCTCCTGAGG - Exonic
1136318001 16:29465490-29465512 TCTGGCCACGTAGTCTCCTGAGG + Exonic
1136432576 16:30204839-30204861 TCTGGCCACGTAGTCTCCTGAGG + Exonic
1138575547 16:57905121-57905143 TATGGAAACTGAGGCTCCAGGGG + Intronic
1139463079 16:67138207-67138229 TCTGGGCCCAAAGTATCCAGTGG - Intronic
1140968332 16:79988794-79988816 TCTGAAGACAAAGCCTCCAGAGG - Intergenic
1141508977 16:84500526-84500548 TCTGCACAGGAAGTCTCCACTGG + Intronic
1149259696 17:54865219-54865241 TCTGCTCAATGAGTCTCCAGAGG - Intergenic
1149715169 17:58782115-58782137 TCTGGTCACTTTGTCTCCAGAGG - Intronic
1150369831 17:64627631-64627653 TCTGGACACCTAGTCTGCTGCGG + Intronic
1155394903 18:25376919-25376941 TCTGGACAGTTAAGCTCCAGGGG + Intergenic
1158439849 18:57466025-57466047 TCTGGAAACTACTTCTCCAAGGG + Intronic
1159568391 18:70083055-70083077 TCAGGACACTAACTTTTCAGAGG - Intronic
1163127809 19:15253752-15253774 TGGGGACACGAAGTCTCCACTGG + Intronic
1165336380 19:35172965-35172987 TCTGGACGCCAAGGCTCGAGTGG - Intergenic
1167283653 19:48586432-48586454 TCTGGATACAGAGACTCCAGGGG - Intronic
1168450915 19:56466028-56466050 TGTGGACACTGAGTCTCTAATGG + Intronic
925280689 2:2682603-2682625 TCACCACACTAAGTCTACAGAGG + Intergenic
927054843 2:19358432-19358454 TCGGGACACTAGAGCTCCAGGGG - Exonic
928611524 2:32996725-32996747 TCAGGAAACTGAGGCTCCAGAGG + Intronic
928637156 2:33258584-33258606 TCATGATACTAAGTGTCCAGGGG - Intronic
931076564 2:58721102-58721124 TCAGAATATTAAGTCTCCAGAGG + Intergenic
931882117 2:66578272-66578294 TCTGGAGACTCAGTTTCCACTGG + Intergenic
933938222 2:87224271-87224293 CCTGCACACAAAGTCTCCAAAGG - Intergenic
936354914 2:111741504-111741526 CCTGCACACAAAGTCTCCAAAGG + Intergenic
939057850 2:137384751-137384773 TCTGGAGACTTTCTCTCCAGAGG - Intronic
940713936 2:157196835-157196857 TGTCCACACTAAGCCTCCAGTGG - Intergenic
944639906 2:201714346-201714368 CCTGGGCACTGAGTCTCTAGTGG + Intronic
945132427 2:206587551-206587573 TCTGGACAATTTGTCACCAGAGG - Intronic
945554416 2:211261936-211261958 CCTGGACAATAAGTCTCCGGAGG + Intergenic
1171936391 20:31278617-31278639 CCTGGAGACCAAGTCTGCAGGGG + Intergenic
1174557776 20:51408039-51408061 TCAGGCCACTGAGTGTCCAGGGG + Intronic
1175306508 20:57979432-57979454 GCTGGACACTAAGACCACAGTGG - Intergenic
1176992208 21:15510559-15510581 TCTGCACACTAAGTCATTAGAGG - Intergenic
1177260120 21:18719227-18719249 TCTGGAGACTCAGCTTCCAGTGG - Intergenic
1177752977 21:25308865-25308887 TCTGGAGCCTAGGTCTGCAGAGG - Intergenic
1177834281 21:26171737-26171759 TCTGGACACTAACTGGACAGTGG - Intergenic
1178973597 21:37202765-37202787 TCATGACTCTAAGTTTCCAGTGG - Exonic
1181510321 22:23386046-23386068 TCTGGGCACTGCGTCTGCAGGGG + Intergenic
1182730830 22:32490748-32490770 TCTGGGCACTAAGGATACAGTGG - Intronic
950940187 3:16884401-16884423 TCCGGACCCTAACTCCCCAGAGG - Intronic
953566091 3:44033222-44033244 TCTGAAAGCTGAGTCTCCAGTGG + Intergenic
961445697 3:126980298-126980320 CCTGGACACGTAGACTCCAGCGG + Intergenic
962564922 3:136648099-136648121 GCTGGACAGTAAGTATCTAGGGG + Intronic
962829064 3:139123679-139123701 TCTGGAAACCAGGTCTCCTGGGG - Intronic
962877801 3:139549247-139549269 ACTGGACTCTATCTCTCCAGAGG - Intergenic
964385221 3:156140160-156140182 GCTGGATACTTAGTGTCCAGAGG - Intronic
965181253 3:165406043-165406065 TCTAGACAATAAGTCTCAAAGGG + Intergenic
965796398 3:172444562-172444584 TTTGGACACTAAGTTTTCATTGG - Intergenic
967094752 3:186168196-186168218 TCTGGACAGTAATTCTCCTTAGG - Intronic
967918373 3:194596353-194596375 TCTGTACTCTTAGTCTCTAGAGG - Intronic
968906176 4:3452046-3452068 TCAGGACACACAGACTCCAGAGG + Intergenic
968966861 4:3773234-3773256 TCTGGAAACTCTGCCTCCAGAGG + Intergenic
969875595 4:10133578-10133600 CCCGAACACTAAGACTCCAGAGG - Intergenic
970670024 4:18386090-18386112 TCTGGACAAACAGTGTCCAGGGG + Intergenic
972345034 4:38185592-38185614 ACTGGACACTAAGTCCCTTGAGG - Intergenic
973340288 4:48996400-48996422 TCTAGACACTAAGTCCCTTGAGG + Intronic
974057435 4:56998235-56998257 TTTGGAGACTAAGTCTGGAGTGG + Intronic
981982209 4:150807474-150807496 TCTGGACACTAAGTCTCCAGTGG + Intronic
983126464 4:163958388-163958410 TCTGGACACTGAATATCCATTGG - Intronic
984078609 4:175214871-175214893 TCTGGCCACTTATTCTCCTGAGG + Intergenic
986647532 5:9932338-9932360 TCTGCCCACAGAGTCTCCAGGGG - Intergenic
994368809 5:98946442-98946464 TCTGAATACTCAGTCTGCAGAGG - Intergenic
999253503 5:150196516-150196538 TCTGGGCACTGGGGCTCCAGAGG + Intronic
999563902 5:152836287-152836309 TCTGGAATGTATGTCTCCAGTGG + Intergenic
1000134011 5:158326703-158326725 TCTGGACACGAACACTCCATTGG + Intergenic
1004963594 6:20821359-20821381 TCTGGACTACAAGCCTCCAGAGG - Intronic
1008839611 6:55886342-55886364 TTTGGAAACTCATTCTCCAGAGG - Intergenic
1009439235 6:63656572-63656594 TCTGGGCAACAAATCTCCAGGGG - Intronic
1015103366 6:129507218-129507240 ACTGCACACTATGTCTCCATTGG - Intronic
1015349846 6:132205001-132205023 TCTGGACACTAGGTCTTCACTGG + Intergenic
1020788578 7:12596980-12597002 TCTGGTCACCAAGCCTTCAGTGG + Intronic
1024063603 7:45716019-45716041 TCTGCCCTCAAAGTCTCCAGTGG - Exonic
1024115722 7:46191310-46191332 TCCGGAAAGTAAATCTCCAGTGG - Intergenic
1024274067 7:47663618-47663640 TCTGGAAACTATATCTCCAGAGG - Intergenic
1026761922 7:73133350-73133372 TCTGGAAACTAATTCTGGAGAGG - Intergenic
1027038263 7:74942174-74942196 TCTGGAAACTAATTCTGGAGAGG - Intergenic
1027085300 7:75259308-75259330 TCTGGAAACTAATTCTGGAGAGG + Intergenic
1027710373 7:81593312-81593334 GGTGGACACTGAGTGTCCAGTGG - Intergenic
1029161055 7:98552213-98552235 TCTGGACACCAAGGCTCAGGTGG + Intergenic
1031452053 7:121934076-121934098 TCTAGAGACTCACTCTCCAGGGG - Intronic
1031536249 7:122936747-122936769 TCTGGAGACTAAGACTCAAGAGG - Intergenic
1031637033 7:124113862-124113884 TCTGGACAGAAACTCTCCAGAGG - Intergenic
1033472383 7:141661709-141661731 TCTGGACACGAATTCTCTGGAGG - Exonic
1035139136 7:156739155-156739177 TCTGGACATTAAGTGACCACTGG + Intronic
1035555230 8:562750-562772 TCTGGAGCCTGACTCTCCAGTGG + Intergenic
1040818360 8:51532196-51532218 TCTGGCCACTGATTCTCAAGTGG - Intronic
1041362447 8:57067339-57067361 CCTGGACCCTTATTCTCCAGAGG + Intergenic
1044624530 8:94223819-94223841 TCTGGAGGCTTAGTCTCAAGTGG - Intergenic
1045131450 8:99158717-99158739 TCTGGGCAGTAGGTCTCCACAGG - Intronic
1045169597 8:99649757-99649779 TCTGGAAATTAAGTCCCCTGTGG - Intronic
1047536528 8:125725203-125725225 TTTAGTCTCTAAGTCTCCAGAGG - Intergenic
1052548206 9:29908339-29908361 TCTGTACACTAAGAATCTAGTGG + Intergenic
1055469726 9:76599290-76599312 TCTAAATACTAAGTTTCCAGGGG + Intergenic
1057047607 9:91898126-91898148 TCTGGAAAGAAAGTCTCAAGTGG + Intronic
1059066763 9:111093763-111093785 CCTGAACACCAAGTCCCCAGAGG + Intergenic
1061370513 9:130195019-130195041 GCTGGACACTAAGCCTGCAGAGG - Intronic
1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG + Intergenic
1187467048 X:19537083-19537105 TGTGGTCACTATGGCTCCAGGGG - Intronic
1189184935 X:39046483-39046505 TCTGGATCCCAAGTCCCCAGAGG + Intergenic
1193700893 X:84759944-84759966 CCTGGATCCTAAGTCTCCTGTGG + Intergenic
1195826268 X:109004122-109004144 TCTGGAAACGAAGCTTCCAGAGG + Intergenic
1198486722 X:137094758-137094780 ACTGGACACTAAGTGTGCAGCGG - Intergenic
1201956508 Y:19629753-19629775 TCTAGACATGAAGTCTACAGAGG + Intergenic